\
| Variant ID: vg0139756098 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 39756098 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 80. )
AGTTCACCTCAAGGTTCTGGAAGCAGTTGCATGAAGCCCTCGGAACCGATCTAAACTTTAGTACAGCTTACCATCCGCAGACCGATGGTCAGACAGAAAG[A/G]
GTAAACCAAATCCTAGAAGACATGCTACGTGCGTGTGCCCTGGATTTCGAAGGCACTTGGGATCGTTGTTTGCCGTATGCTGAGTTCTTATACAACAACA
TGTTGTTGTATAAGAACTCAGCATACGGCAAACAACGATCCCAAGTGCCTTCGAAATCCAGGGCACACGCACGTAGCATGTCTTCTAGGATTTGGTTTAC[T/C]
CTTTCTGTCTGACCATCGGTCTGCGGATGGTAAGCTGTACTAAAGTTTAGATCGGTTCCGAGGGCTTCATGCAACTGCTTCCAGAACCTTGAGGTGAACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.50% | 7.40% | 17.69% | 47.38% | NA |
| All Indica | 2759 | 4.00% | 12.40% | 28.63% | 54.98% | NA |
| All Japonica | 1512 | 75.60% | 0.10% | 0.60% | 23.68% | NA |
| Aus | 269 | 2.60% | 0.00% | 8.18% | 89.22% | NA |
| Indica I | 595 | 3.40% | 7.60% | 16.64% | 72.44% | NA |
| Indica II | 465 | 2.20% | 4.10% | 23.87% | 69.89% | NA |
| Indica III | 913 | 3.60% | 23.30% | 41.07% | 31.98% | NA |
| Indica Intermediate | 786 | 6.00% | 8.30% | 26.08% | 59.67% | NA |
| Temperate Japonica | 767 | 97.80% | 0.00% | 0.13% | 2.09% | NA |
| Tropical Japonica | 504 | 55.40% | 0.20% | 0.60% | 43.85% | NA |
| Japonica Intermediate | 241 | 47.30% | 0.40% | 2.07% | 50.21% | NA |
| VI/Aromatic | 96 | 2.10% | 1.00% | 7.29% | 89.58% | NA |
| Intermediate | 90 | 44.40% | 4.40% | 8.89% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139756098 | A -> G | LOC_Os01g68410.1 | splice_region_variant&synonymous_variant ; p.Arg1336Arg; LOW | synonymous_codon | Average:14.469; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0139756098 | A -> DEL | LOC_Os01g68410.1 | N | frameshift_variant | Average:14.469; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139756098 | NA | 1.59E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 8.05E-07 | 9.94E-08 | mr1116 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 2.60E-08 | 1.21E-09 | mr1117 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 4.85E-08 | 5.63E-10 | mr1119 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 8.52E-07 | 4.49E-08 | mr1120 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | NA | 1.54E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 1.76E-06 | 7.36E-08 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | NA | 2.53E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 8.08E-07 | 4.39E-08 | mr1114_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 3.41E-08 | 1.05E-09 | mr1117_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 1.65E-06 | 4.29E-08 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 3.25E-06 | 2.97E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 2.63E-06 | 1.07E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 4.46E-06 | 1.14E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139756098 | 2.67E-07 | 1.61E-08 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |