\
| Variant ID: vg0139710848 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 39710848 |
| Reference Allele: GTGGAACCA | Alternative Allele: ATGGAACCA,G |
| Primary Allele: GTGGAACCA | Secondary Allele: ATGGAACCA |
Inferred Ancestral Allele: Not determined.
TCGTTTTCCGGCGACCTTCGATCAGCAACGGACCTCGGCAAATCGGCTTCCACCAGTGCAACGTTGAAGAAACTCCAGGAGGATGGCGCTCTTCCTGGCC[GTGGAACCA/ATGGAACCA,G]
TGGAGAGTGAAGCAGGAGGTACTAATCCTCAGCCCATCTTGGGTCGCATGGTTGCGATCGAAGATTATGTTCTCTGCGGTTTTCTCCCTCCTCCTTCCGA
TCGGAAGGAGGAGGGAGAAAACCGCAGAGAACATAATCTTCGATCGCAACCATGCGACCCAAGATGGGCTGAGGATTAGTACCTCCTGCTTCACTCTCCA[TGGTTCCAC/TGGTTCCAT,C]
GGCCAGGAAGAGCGCCATCCTCCTGGAGTTTCTTCAACGTTGCACTGGTGGAAGCCGATTTGCCGAGGTCCGTTGCTGATCGAAGGTCGCCGGAAAACGA
| Populations | Population Size | Frequency of GTGGAACCA(primary allele) | Frequency of ATGGAACCA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 8.70% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 0.20% | 1.52% | 0.00% | NA |
| Aus | 269 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 0.00% | 4.56% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139710848 | GTGGAACCA -> G | LOC_Os01g68340.1 | frameshift_variant&start_lost ; p.Met1fs; HIGH | N | Average:46.669; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0139710848 | GTGGAACCA -> G | LOC_Os01g68330.1 | upstream_gene_variant ; 2446.0bp to feature; MODIFIER | N | Average:46.669; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0139710848 | GTGGAACCA -> G | LOC_Os01g68340.1 | upstream_gene_variant ; 7.0bp to feature; MODIFIER | N | Average:46.669; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0139710848 | GTGGAACCA -> G | LOC_Os01g68350.1 | downstream_gene_variant ; 2880.0bp to feature; MODIFIER | N | Average:46.669; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0139710848 | GTGGAACCA -> ATGGAACCA | LOC_Os01g68330.1 | upstream_gene_variant ; 2445.0bp to feature; MODIFIER | silent_mutation | Average:46.669; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0139710848 | GTGGAACCA -> ATGGAACCA | LOC_Os01g68340.1 | upstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:46.669; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0139710848 | GTGGAACCA -> ATGGAACCA | LOC_Os01g68350.1 | downstream_gene_variant ; 2881.0bp to feature; MODIFIER | silent_mutation | Average:46.669; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0139710848 | GTGGAACCA -> ATGGAACCA | LOC_Os01g68330-LOC_Os01g68340 | intergenic_region ; MODIFIER | silent_mutation | Average:46.669; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139710848 | NA | 3.10E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | NA | 9.92E-15 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | NA | 2.80E-08 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | NA | 3.92E-14 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | NA | 2.80E-08 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | NA | 6.21E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 1.79E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 2.98E-07 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 1.51E-07 | NA | mr1117_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 5.19E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 2.11E-07 | NA | mr1119_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 8.78E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 7.55E-08 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | NA | 9.24E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 2.53E-07 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 3.83E-08 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 2.09E-07 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | 1.35E-07 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | NA | 3.61E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139710848 | NA | 7.97E-08 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |