\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139656695:

Variant ID: vg0139656695 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39656695
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGGAATATTGATTCAAACAGCAGACTGAGCGTAGTGTATTTACATCAAAGGATCAGTTACATACCTTGAAAGTTAAAATTGTCACTCATCCCTTCATA[G/T]
TGTTAGGAAACAGGAACATCAAGAAAATAAACAATGACGAACTGACCATTCCTGATAGGTTTACAATGAGGCAAAAATTAGCAGTTGCTTAATTGCTTTA

Reverse complement sequence

TAAAGCAATTAAGCAACTGCTAATTTTTGCCTCATTGTAAACCTATCAGGAATGGTCAGTTCGTCATTGTTTATTTTCTTGATGTTCCTGTTTCCTAACA[C/A]
TATGAAGGGATGAGTGACAATTTTAACTTTCAAGGTATGTAACTGATCCTTTGATGTAAATACACTACGCTCAGTCTGCTGTTTGAATCAATATTCCAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.60% 1.60% 0.78% 0.00% NA
All Indica  2759 95.90% 2.80% 1.34% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.00% 2.70% 1.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.70% 1.10% 0.22% 0.00% NA
Indica Intermediate  786 90.10% 6.50% 3.44% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139656695 G -> T LOC_Os01g68230.1 3_prime_UTR_variant ; 435.0bp to feature; MODIFIER silent_mutation Average:46.204; most accessible tissue: Callus, score: 82.273 N N N N
vg0139656695 G -> T LOC_Os01g68230.2 3_prime_UTR_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:46.204; most accessible tissue: Callus, score: 82.273 N N N N
vg0139656695 G -> T LOC_Os01g68240.1 upstream_gene_variant ; 1248.0bp to feature; MODIFIER silent_mutation Average:46.204; most accessible tissue: Callus, score: 82.273 N N N N
vg0139656695 G -> T LOC_Os01g68220.1 downstream_gene_variant ; 3039.0bp to feature; MODIFIER silent_mutation Average:46.204; most accessible tissue: Callus, score: 82.273 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139656695 NA 5.88E-07 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 2.34E-07 1.10E-07 mr1246 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 NA 6.37E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 NA 2.49E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 NA 1.86E-06 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 NA 4.89E-08 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 NA 5.92E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 1.63E-07 3.60E-06 mr1246_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 NA 4.34E-06 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695 NA 7.59E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251