Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139656695:

Variant ID: vg0139656695 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 39656695
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGGAATATTGATTCAAACAGCAGACTGAGCGTAGTGTATTTACATCAAAGGATCAGTTACATACCTTGAAAGTTAAAATTGTCACTCATCCCTTCATA[G/T]
TGTTAGGAAACAGGAACATCAAGAAAATAAACAATGACGAACTGACCATTCCTGATAGGTTTACAATGAGGCAAAAATTAGCAGTTGCTTAATTGCTTTA

Reverse complement sequence

TAAAGCAATTAAGCAACTGCTAATTTTTGCCTCATTGTAAACCTATCAGGAATGGTCAGTTCGTCATTGTTTATTTTCTTGATGTTCCTGTTTCCTAACA[C/A]
TATGAAGGGATGAGTGACAATTTTAACTTTCAAGGTATGTAACTGATCCTTTGATGTAAATACACTACGCTCAGTCTGCTGTTTGAATCAATATTCCAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	1.60%	0.78%	0.00%	NA
All Indica	2759	95.90%	2.80%	1.34%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.00%	2.70%	1.34%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.70%	1.10%	0.22%	0.00%	NA
Indica Intermediate	786	90.10%	6.50%	3.44%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139656695	G -> T	LOC_Os01g68230.1	3_prime_UTR_variant ; 435.0bp to feature; MODIFIER	silent_mutation	Average:46.204; most accessible tissue: Callus, score: 82.273	N	N	N	N
vg0139656695	G -> T	LOC_Os01g68230.2	3_prime_UTR_variant ; 3.0bp to feature; MODIFIER	silent_mutation	Average:46.204; most accessible tissue: Callus, score: 82.273	N	N	N	N
vg0139656695	G -> T	LOC_Os01g68240.1	upstream_gene_variant ; 1248.0bp to feature; MODIFIER	silent_mutation	Average:46.204; most accessible tissue: Callus, score: 82.273	N	N	N	N
vg0139656695	G -> T	LOC_Os01g68220.1	downstream_gene_variant ; 3039.0bp to feature; MODIFIER	silent_mutation	Average:46.204; most accessible tissue: Callus, score: 82.273	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139656695	NA	5.88E-07	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	2.34E-07	1.10E-07	mr1246	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	NA	6.37E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	NA	2.49E-06	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	NA	1.86E-06	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	NA	4.89E-08	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	NA	5.92E-08	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	1.63E-07	3.60E-06	mr1246_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	NA	4.34E-06	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139656695	NA	7.59E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251