Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139634443:

Variant ID: vg0139634443 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39634443
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCTCCTCCTCGCCGCCGCCGTGCTCCACCCGCTGCTCTTCCTCCTCCTCCTCGCCGCCGCCGCCGCCGTGATGGGGACGCATTGCTATCGCCGGTGGG[C/G]
GGAGAGGGAGAGAAGGGGCTCACAGGTTTACGCCTTCGCCCCTTCTCACCCTTCCACACGGTTGTCGCCCACCTCGCCGCTGACCACGACGACCTCCTCC

Reverse complement sequence

GGAGGAGGTCGTCGTGGTCAGCGGCGAGGTGGGCGACAACCGTGTGGAAGGGTGAGAAGGGGCGAAGGCGTAAACCTGTGAGCCCCTTCTCTCCCTCTCC[G/C]
CCCACCGGCGATAGCAATGCGTCCCCATCACGGCGGCGGCGGCGGCGAGGAGGAGGAGGAAGAGCAGCGGGTGGAGCACGGCGGCGGCGAGGAGGAGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 1.40% 5.88% 3.77% NA
All Indica  2759 87.00% 0.10% 6.96% 6.02% NA
All Japonica  1512 90.70% 4.20% 4.50% 0.60% NA
Aus  269 96.30% 0.00% 3.72% 0.00% NA
Indica I  595 88.90% 0.30% 5.04% 5.71% NA
Indica II  465 79.40% 0.00% 13.76% 6.88% NA
Indica III  913 90.70% 0.00% 4.16% 5.15% NA
Indica Intermediate  786 85.60% 0.00% 7.63% 6.74% NA
Temperate Japonica  767 85.80% 7.80% 6.39% 0.00% NA
Tropical Japonica  504 97.20% 0.60% 1.39% 0.79% NA
Japonica Intermediate  241 92.50% 0.40% 4.98% 2.07% NA
VI/Aromatic  96 93.80% 1.00% 4.17% 1.04% NA
Intermediate  90 92.20% 1.10% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139634443 C -> G LOC_Os01g68160.1 upstream_gene_variant ; 589.0bp to feature; MODIFIER silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0139634443 C -> G LOC_Os01g68179.1 upstream_gene_variant ; 236.0bp to feature; MODIFIER silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0139634443 C -> G LOC_Os01g68200.1 upstream_gene_variant ; 4338.0bp to feature; MODIFIER silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0139634443 C -> G LOC_Os01g68160.2 upstream_gene_variant ; 589.0bp to feature; MODIFIER silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0139634443 C -> G LOC_Os01g68160.3 upstream_gene_variant ; 589.0bp to feature; MODIFIER silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0139634443 C -> G LOC_Os01g68160.4 upstream_gene_variant ; 589.0bp to feature; MODIFIER silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0139634443 C -> G LOC_Os01g68160.5 upstream_gene_variant ; 589.0bp to feature; MODIFIER silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0139634443 C -> G LOC_Os01g68160-LOC_Os01g68179 intergenic_region ; MODIFIER silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0139634443 C -> DEL N N silent_mutation Average:84.691; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0139634443 C G 0.09 0.08 0.09 0.08 0.09 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139634443 NA 2.68E-08 Awn_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652