\
| Variant ID: vg0139482305 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 39482305 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACATATGGTGGGCTGTGGGTGCATGGTTTTGATGGTCGCGCCCATGGTACTTAAGGACCGGTTCGCGGGAAACCCTGAAAGAATTCCTCGTACTTGCCA[C/A]
AAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTTTAGCTGATGCATCTAGGCAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGAC
GTCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTGCCTAGATGCATCAGCTAAAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTT[G/T]
TGGCAAGTACGAGGAATTCTTTCAGGGTTTCCCGCGAACCGGTCCTTAAGTACCATGGGCGCGACCATCAAAACCATGCACCCACAGCCCACCATATGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 1.10% | 1.08% | 0.87% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.14% | 0.07% | NA |
| All Japonica | 1512 | 91.90% | 3.40% | 3.04% | 1.59% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 88.00% | 6.80% | 5.22% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 0.00% | 1.19% | 4.17% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 1.04% | 14.58% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139482305 | C -> A | LOC_Os01g67930.1 | upstream_gene_variant ; 3643.0bp to feature; MODIFIER | silent_mutation | Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482305 | C -> A | LOC_Os01g67940.1 | upstream_gene_variant ; 1252.0bp to feature; MODIFIER | silent_mutation | Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482305 | C -> A | LOC_Os01g67950.1 | upstream_gene_variant ; 1450.0bp to feature; MODIFIER | silent_mutation | Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482305 | C -> A | LOC_Os01g67960.1 | upstream_gene_variant ; 4627.0bp to feature; MODIFIER | silent_mutation | Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482305 | C -> A | LOC_Os01g67940-LOC_Os01g67950 | intergenic_region ; MODIFIER | silent_mutation | Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482305 | C -> DEL | N | N | silent_mutation | Average:42.233; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139482305 | NA | 3.94E-08 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482305 | 1.19E-08 | 1.19E-08 | mr1369 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482305 | 2.96E-06 | 5.95E-09 | mr1453 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482305 | NA | 3.07E-09 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482305 | NA | 3.72E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |