\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139384190:

Variant ID: vg0139384190 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 39384190
Reference Allele: AAlternative Allele: G,AAG
Primary Allele: GSecondary Allele: AAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAACGGCCTCAATCAACACCCAACACAATACACGGGAGAACATACAAGCCTACATACGCCAAGACAAGCCGCCGGATATCGATTTCAGGGATAGGCAC[A/G,AAG]
GCTAGTCTCCTACGGTGTCTCCAGATACAGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCGAGCACGGATTCGAGGAGGAAAGCTACCCTGTTGT

Reverse complement sequence

ACAACAGGGTAGCTTTCCTCCTCGAATCCGTGCTCGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACTGTATCTGGAGACACCGTAGGAGACTAGC[T/C,CTT]
GTGCCTATCCCTGAAATCGATATCCGGCGGCTTGTCTTGGCGTATGTAGGCTTGTATGTTCTCCCGTGTATTGTGTTGGGTGTTGATTGAGGCCGTTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of AAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 15.10% 2.60% 0.00% A: 11.17%
All Indica  2759 98.10% 0.90% 0.43% 0.00% A: 0.54%
All Japonica  1512 15.60% 44.30% 7.08% 0.00% A: 33.00%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 1.00% 0.50% 0.00% A: 0.67%
Indica II  465 99.10% 0.40% 0.22% 0.00% A: 0.22%
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 2.00% 1.02% 0.00% A: 1.27%
Temperate Japonica  767 1.60% 30.50% 11.34% 0.00% A: 56.58%
Tropical Japonica  504 38.10% 55.20% 2.18% 0.00% A: 4.56%
Japonica Intermediate  241 13.30% 65.60% 3.73% 0.00% A: 17.43%
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 61.10% 20.00% 3.33% 0.00% A: 15.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139384190 A -> G LOC_Os01g67750.1 upstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0139384190 A -> G LOC_Os01g67760.1 downstream_gene_variant ; 1826.0bp to feature; MODIFIER silent_mutation Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0139384190 A -> G LOC_Os01g67770.1 downstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0139384190 A -> G LOC_Os01g67760-LOC_Os01g67770 intergenic_region ; MODIFIER silent_mutation Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0139384190 A -> AAG LOC_Os01g67750.1 upstream_gene_variant ; 4623.0bp to feature; MODIFIER silent_mutation Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0139384190 A -> AAG LOC_Os01g67760.1 downstream_gene_variant ; 1827.0bp to feature; MODIFIER silent_mutation Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0139384190 A -> AAG LOC_Os01g67770.1 downstream_gene_variant ; 3039.0bp to feature; MODIFIER silent_mutation Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0139384190 A -> AAG LOC_Os01g67760-LOC_Os01g67770 intergenic_region ; MODIFIER silent_mutation Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139384190 NA 1.56E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 NA 3.48E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 NA 5.40E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 NA 7.10E-12 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 NA 4.37E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 5.53E-06 1.70E-10 mr1815 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 1.26E-06 1.26E-06 mr1815 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 NA 1.27E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 NA 2.68E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139384190 NA 1.72E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251