\
| Variant ID: vg0139384190 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 39384190 |
| Reference Allele: A | Alternative Allele: G,AAG |
| Primary Allele: G | Secondary Allele: AAG |
Inferred Ancestral Allele: Not determined.
ATCAACGGCCTCAATCAACACCCAACACAATACACGGGAGAACATACAAGCCTACATACGCCAAGACAAGCCGCCGGATATCGATTTCAGGGATAGGCAC[A/G,AAG]
GCTAGTCTCCTACGGTGTCTCCAGATACAGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCGAGCACGGATTCGAGGAGGAAAGCTACCCTGTTGT
ACAACAGGGTAGCTTTCCTCCTCGAATCCGTGCTCGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACTGTATCTGGAGACACCGTAGGAGACTAGC[T/C,CTT]
GTGCCTATCCCTGAAATCGATATCCGGCGGCTTGTCTTGGCGTATGTAGGCTTGTATGTTCTCCCGTGTATTGTGTTGGGTGTTGATTGAGGCCGTTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of AAG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.10% | 15.10% | 2.60% | 0.00% | A: 11.17% |
| All Indica | 2759 | 98.10% | 0.90% | 0.43% | 0.00% | A: 0.54% |
| All Japonica | 1512 | 15.60% | 44.30% | 7.08% | 0.00% | A: 33.00% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.00% | 0.50% | 0.00% | A: 0.67% |
| Indica II | 465 | 99.10% | 0.40% | 0.22% | 0.00% | A: 0.22% |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 2.00% | 1.02% | 0.00% | A: 1.27% |
| Temperate Japonica | 767 | 1.60% | 30.50% | 11.34% | 0.00% | A: 56.58% |
| Tropical Japonica | 504 | 38.10% | 55.20% | 2.18% | 0.00% | A: 4.56% |
| Japonica Intermediate | 241 | 13.30% | 65.60% | 3.73% | 0.00% | A: 17.43% |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 20.00% | 3.33% | 0.00% | A: 15.56% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139384190 | A -> G | LOC_Os01g67750.1 | upstream_gene_variant ; 4622.0bp to feature; MODIFIER | silent_mutation | Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0139384190 | A -> G | LOC_Os01g67760.1 | downstream_gene_variant ; 1826.0bp to feature; MODIFIER | silent_mutation | Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0139384190 | A -> G | LOC_Os01g67770.1 | downstream_gene_variant ; 3040.0bp to feature; MODIFIER | silent_mutation | Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0139384190 | A -> G | LOC_Os01g67760-LOC_Os01g67770 | intergenic_region ; MODIFIER | silent_mutation | Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0139384190 | A -> AAG | LOC_Os01g67750.1 | upstream_gene_variant ; 4623.0bp to feature; MODIFIER | silent_mutation | Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0139384190 | A -> AAG | LOC_Os01g67760.1 | downstream_gene_variant ; 1827.0bp to feature; MODIFIER | silent_mutation | Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0139384190 | A -> AAG | LOC_Os01g67770.1 | downstream_gene_variant ; 3039.0bp to feature; MODIFIER | silent_mutation | Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0139384190 | A -> AAG | LOC_Os01g67760-LOC_Os01g67770 | intergenic_region ; MODIFIER | silent_mutation | Average:33.387; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139384190 | NA | 1.56E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | NA | 3.48E-06 | mr1029 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | NA | 5.40E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | NA | 7.10E-12 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | NA | 4.37E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | 5.53E-06 | 1.70E-10 | mr1815 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | 1.26E-06 | 1.26E-06 | mr1815 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | NA | 1.27E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | NA | 2.68E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139384190 | NA | 1.72E-07 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |