\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139382231:

Variant ID: vg0139382231 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39382231
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCTCGTACCACAACTCCAAATGATCGAGGGACACCTACTCACCGGTTCTCAACCAGTTGATCGTAGTGATCTCTCGTACATTTGCTTCAAGTGGTCGA[A/G]
TTACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTTTCTCCGGCTACTTCCGCTTTAAGTGGTCAAGTTACGACTACTGCCTGGTTCTCGACCAGC

Reverse complement sequence

GCTGGTCGAGAACCAGGCAGTAGTCGTAACTTGACCACTTAAAGCGGAAGTAGCCGGAGAAACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTAA[T/C]
TCGACCACTTGAAGCAAATGTACGAGAGATCACTACGATCAACTGGTTGAGAACCGGTGAGTAGGTGTCCCTCGATCATTTGGAGTTGTGGTACGAGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.70% 21.00% 13.48% 20.78% NA
All Indica  2759 58.70% 2.00% 5.47% 33.89% NA
All Japonica  1512 26.70% 60.60% 12.43% 0.33% NA
Aus  269 4.50% 1.10% 83.27% 11.15% NA
Indica I  595 32.30% 2.50% 3.03% 62.18% NA
Indica II  465 88.80% 0.40% 3.23% 7.53% NA
Indica III  913 54.70% 0.80% 6.79% 37.79% NA
Indica Intermediate  786 65.50% 3.80% 7.12% 23.54% NA
Temperate Japonica  767 10.40% 86.20% 3.26% 0.13% NA
Tropical Japonica  504 56.70% 12.90% 29.96% 0.40% NA
Japonica Intermediate  241 15.40% 78.80% 4.98% 0.83% NA
VI/Aromatic  96 31.20% 3.10% 63.54% 2.08% NA
Intermediate  90 54.40% 20.00% 14.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139382231 A -> G LOC_Os01g67760.1 missense_variant ; p.Asn127Ser; MODERATE nonsynonymous_codon Average:11.825; most accessible tissue: Callus, score: 34.369 benign -1.386 TOLERATED 1.00
vg0139382231 A -> DEL LOC_Os01g67760.1 N frameshift_variant Average:11.825; most accessible tissue: Callus, score: 34.369 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139382231 NA 3.72E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 1.94E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 3.56E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 2.31E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 2.22E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 6.18E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 1.71E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 4.96E-10 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 6.73E-07 6.73E-07 mr1815 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 5.76E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139382231 NA 4.78E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251