Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139155508:

Variant ID: vg0139155508 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 39155508
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTTGCGTGCGGTTAATTAAGACATCCGCCTGCAAAAATAGTCTCATTTTTGCGTGCCGTTCACTTAATATGTCCATTTGTGAAAATCAATTTTTTCG[T/C]
GCAGTCCTCTTAAATGGACCGCACTAGAAAATGAGCTGATTTTTTCGTGCGGATCGAGTTACCGCCCGCCCGCAATCTAAAAGTGTCCCTGTCCAGGAAA

Reverse complement sequence

TTTCCTGGACAGGGACACTTTTAGATTGCGGGCGGGCGGTAACTCGATCCGCACGAAAAAATCAGCTCATTTTCTAGTGCGGTCCATTTAAGAGGACTGC[A/G]
CGAAAAAATTGATTTTCACAAATGGACATATTAAGTGAACGGCACGCAAAAATGAGACTATTTTTGCAGGCGGATGTCTTAATTAACCGCACGCAAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	12.30%	0.49%	1.78%	NA
All Indica	2759	78.80%	20.90%	0.18%	0.07%	NA
All Japonica	1512	95.80%	0.10%	0.00%	4.17%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	47.40%	52.40%	0.17%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	90.00%	9.70%	0.11%	0.11%	NA
Indica Intermediate	786	78.90%	20.60%	0.38%	0.13%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	88.50%	0.00%	0.00%	11.51%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	67.70%	0.00%	15.62%	16.67%	NA
Intermediate	90	90.00%	3.30%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139155508	T -> DEL	N	N	silent_mutation	Average:54.478; most accessible tissue: Callus, score: 68.644	N	N	N	N
vg0139155508	T -> C	LOC_Os01g67420.1	upstream_gene_variant ; 2645.0bp to feature; MODIFIER	silent_mutation	Average:54.478; most accessible tissue: Callus, score: 68.644	N	N	N	N
vg0139155508	T -> C	LOC_Os01g67410-LOC_Os01g67420	intergenic_region ; MODIFIER	silent_mutation	Average:54.478; most accessible tissue: Callus, score: 68.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139155508	NA	2.92E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139155508	NA	6.63E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139155508	NA	3.34E-06	mr1510_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139155508	NA	1.88E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139155508	NA	5.40E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139155508	NA	2.97E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251