\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139109454:

Variant ID: vg0139109454 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39109454
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAATTGCATTGGGATTTGGGAGTAGATAAAGATAGGAATAATTGCATTAGGATTTAATAAAGTTCGGGTATTGTAGTCTTTTTTTTTAATTTTATATT[G/A]
GTATGTGTGATGGATAAAACTAAACTTATTTCGTAACGAAGAGAGTACTCCCTATGTTTCTTAGTTCTTCGAGCTGAAAAATGCTCTTTGCTTTTAAATT

Reverse complement sequence

AATTTAAAAGCAAAGAGCATTTTTCAGCTCGAAGAACTAAGAAACATAGGGAGTACTCTCTTCGTTACGAAATAAGTTTAGTTTTATCCATCACACATAC[C/T]
AATATAAAATTAAAAAAAAAGACTACAATACCCGAACTTTATTAAATCCTAATGCAATTATTCCTATCTTTATCTACTCCCAAATCCCAATGCAATTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 1.80% 1.16% 4.08% NA
All Indica  2759 99.60% 0.20% 0.07% 0.11% NA
All Japonica  1512 81.50% 5.20% 3.44% 9.79% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 0.80% 0.34% 0.17% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 99.90% 0.00% 0.00% 0.13% NA
Temperate Japonica  767 74.80% 8.70% 5.48% 10.95% NA
Tropical Japonica  504 88.10% 0.40% 0.20% 11.31% NA
Japonica Intermediate  241 89.20% 4.10% 3.73% 2.90% NA
VI/Aromatic  96 61.50% 0.00% 1.04% 37.50% NA
Intermediate  90 93.30% 0.00% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139109454 G -> A LOC_Os01g67360.1 upstream_gene_variant ; 3690.0bp to feature; MODIFIER silent_mutation Average:35.467; most accessible tissue: Callus, score: 60.034 N N N N
vg0139109454 G -> A LOC_Os01g67360-LOC_Os01g67364 intergenic_region ; MODIFIER silent_mutation Average:35.467; most accessible tissue: Callus, score: 60.034 N N N N
vg0139109454 G -> DEL N N silent_mutation Average:35.467; most accessible tissue: Callus, score: 60.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139109454 NA 1.94E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454 NA 2.89E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454 4.21E-08 4.21E-08 mr1024_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454 NA 9.09E-07 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454 NA 1.78E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454 NA 5.28E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454 NA 2.27E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454 7.02E-07 7.02E-07 mr1940_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251