Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139109454:

Variant ID: vg0139109454 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 39109454
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAATTGCATTGGGATTTGGGAGTAGATAAAGATAGGAATAATTGCATTAGGATTTAATAAAGTTCGGGTATTGTAGTCTTTTTTTTTAATTTTATATT[G/A]
GTATGTGTGATGGATAAAACTAAACTTATTTCGTAACGAAGAGAGTACTCCCTATGTTTCTTAGTTCTTCGAGCTGAAAAATGCTCTTTGCTTTTAAATT

Reverse complement sequence

AATTTAAAAGCAAAGAGCATTTTTCAGCTCGAAGAACTAAGAAACATAGGGAGTACTCTCTTCGTTACGAAATAAGTTTAGTTTTATCCATCACACATAC[C/T]
AATATAAAATTAAAAAAAAAGACTACAATACCCGAACTTTATTAAATCCTAATGCAATTATTCCTATCTTTATCTACTCCCAAATCCCAATGCAATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	1.80%	1.16%	4.08%	NA
All Indica	2759	99.60%	0.20%	0.07%	0.11%	NA
All Japonica	1512	81.50%	5.20%	3.44%	9.79%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	0.80%	0.34%	0.17%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	99.90%	0.00%	0.00%	0.13%	NA
Temperate Japonica	767	74.80%	8.70%	5.48%	10.95%	NA
Tropical Japonica	504	88.10%	0.40%	0.20%	11.31%	NA
Japonica Intermediate	241	89.20%	4.10%	3.73%	2.90%	NA
VI/Aromatic	96	61.50%	0.00%	1.04%	37.50%	NA
Intermediate	90	93.30%	0.00%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139109454	G -> A	LOC_Os01g67360.1	upstream_gene_variant ; 3690.0bp to feature; MODIFIER	silent_mutation	Average:35.467; most accessible tissue: Callus, score: 60.034	N	N	N	N
vg0139109454	G -> A	LOC_Os01g67360-LOC_Os01g67364	intergenic_region ; MODIFIER	silent_mutation	Average:35.467; most accessible tissue: Callus, score: 60.034	N	N	N	N
vg0139109454	G -> DEL	N	N	silent_mutation	Average:35.467; most accessible tissue: Callus, score: 60.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139109454	NA	1.94E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454	NA	2.89E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454	4.21E-08	4.21E-08	mr1024_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454	NA	9.09E-07	mr1038_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454	NA	1.78E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454	NA	5.28E-06	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454	NA	2.27E-06	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139109454	7.02E-07	7.02E-07	mr1940_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251