\
| Variant ID: vg0139109454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 39109454 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAATTGCATTGGGATTTGGGAGTAGATAAAGATAGGAATAATTGCATTAGGATTTAATAAAGTTCGGGTATTGTAGTCTTTTTTTTTAATTTTATATT[G/A]
GTATGTGTGATGGATAAAACTAAACTTATTTCGTAACGAAGAGAGTACTCCCTATGTTTCTTAGTTCTTCGAGCTGAAAAATGCTCTTTGCTTTTAAATT
AATTTAAAAGCAAAGAGCATTTTTCAGCTCGAAGAACTAAGAAACATAGGGAGTACTCTCTTCGTTACGAAATAAGTTTAGTTTTATCCATCACACATAC[C/T]
AATATAAAATTAAAAAAAAAGACTACAATACCCGAACTTTATTAAATCCTAATGCAATTATTCCTATCTTTATCTACTCCCAAATCCCAATGCAATTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 1.80% | 1.16% | 4.08% | NA |
| All Indica | 2759 | 99.60% | 0.20% | 0.07% | 0.11% | NA |
| All Japonica | 1512 | 81.50% | 5.20% | 3.44% | 9.79% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.80% | 0.34% | 0.17% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 74.80% | 8.70% | 5.48% | 10.95% | NA |
| Tropical Japonica | 504 | 88.10% | 0.40% | 0.20% | 11.31% | NA |
| Japonica Intermediate | 241 | 89.20% | 4.10% | 3.73% | 2.90% | NA |
| VI/Aromatic | 96 | 61.50% | 0.00% | 1.04% | 37.50% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139109454 | G -> A | LOC_Os01g67360.1 | upstream_gene_variant ; 3690.0bp to feature; MODIFIER | silent_mutation | Average:35.467; most accessible tissue: Callus, score: 60.034 | N | N | N | N |
| vg0139109454 | G -> A | LOC_Os01g67360-LOC_Os01g67364 | intergenic_region ; MODIFIER | silent_mutation | Average:35.467; most accessible tissue: Callus, score: 60.034 | N | N | N | N |
| vg0139109454 | G -> DEL | N | N | silent_mutation | Average:35.467; most accessible tissue: Callus, score: 60.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139109454 | NA | 1.94E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139109454 | NA | 2.89E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139109454 | 4.21E-08 | 4.21E-08 | mr1024_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139109454 | NA | 9.09E-07 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139109454 | NA | 1.78E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139109454 | NA | 5.28E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139109454 | NA | 2.27E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139109454 | 7.02E-07 | 7.02E-07 | mr1940_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |