Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139101409:

Variant ID: vg0139101409 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39101409
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AGACGAGGCAGAGAAGGCTTATCGCTTTGAGGTATTCAAGTCTACTGTCCAGTATGTCGAAAAGTTCAATGCTGAACAGGTGAAAAAATATGGTTGCTGC[A/G]
AATGCACACTAGGTACAAACAAATTTGCGGATCTCACTGTGGAGGAAGTCTCGAACAAGTTTTGTGGCAAAAGAAGCAGGCAGTGTTAGCTCGGTATATT

Reverse complement sequence

AATATACCGAGCTAACACTGCCTGCTTCTTTTGCCACAAAACTTGTTCGAGACTTCCTCCACAGTGAGATCCGCAAATTTGTTTGTACCTAGTGTGCATT[T/C]
GCAGCAACCATATTTTTTCACCTGTTCAGCATTGAACTTTTCGACATACTGGACAGTAGACTTGAATACCTCAAAGCGATAAGCCTTCTCTGCCTCGTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 4.30% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 90.10% 9.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 88.80% 11.20% 0.00% 0.00% NA
Tropical Japonica  504 88.70% 11.30% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139101409 A -> G LOC_Os01g67350.1 missense_variant ; p.Lys140Glu; MODERATE nonsynonymous_codon ; K140E Average:65.058; most accessible tissue: Callus, score: 76.975 unknown unknown TOLERATED 0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139101409 NA 1.09E-08 mr1028 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 6.71E-06 mr1245 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 1.05E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 4.70E-07 4.70E-07 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 3.10E-08 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 1.81E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 1.03E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 1.11E-09 mr1652 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 5.56E-06 mr1683 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 1.42E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 7.08E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 7.54E-06 mr1909 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 4.14E-06 mr1921 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 7.67E-07 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 7.97E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139101409 NA 4.34E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251