\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139060178:

Variant ID: vg0139060178 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39060178
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAGCCTAATTAATCCATAATTAGCACATGTTTACTGTAGTATCATATAGGCTAATCATAGATTAATTAGTCTCAATAAATTTGTCTCGCGAATTAGTC[C/T]
AGGTTATGGAATGAGTTTTATTATTAGTCTACATTTAATACCTATAATTAGTGTCCAAACATCCGATCTGATAGGGACTAAAATTTTAGTCCCTAATCCA

Reverse complement sequence

TGGATTAGGGACTAAAATTTTAGTCCCTATCAGATCGGATGTTTGGACACTAATTATAGGTATTAAATGTAGACTAATAATAAAACTCATTCCATAACCT[G/A]
GACTAATTCGCGAGACAAATTTATTGAGACTAATTAATCTATGATTAGCCTATATGATACTACAGTAAACATGTGCTAATTATGGATTAATTAGGCTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.30% 0.11% 0.00% NA
All Indica  2759 27.30% 72.60% 0.18% 0.00% NA
All Japonica  1512 92.40% 7.60% 0.00% 0.00% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 61.50% 38.00% 0.50% 0.00% NA
Indica II  465 4.30% 95.70% 0.00% 0.00% NA
Indica III  913 15.80% 84.20% 0.00% 0.00% NA
Indica Intermediate  786 28.20% 71.50% 0.25% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 83.70% 16.30% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139060178 C -> T LOC_Os01g67290.1 upstream_gene_variant ; 1204.0bp to feature; MODIFIER silent_mutation Average:79.066; most accessible tissue: Callus, score: 91.518 N N N N
vg0139060178 C -> T LOC_Os01g67300.1 upstream_gene_variant ; 3319.0bp to feature; MODIFIER silent_mutation Average:79.066; most accessible tissue: Callus, score: 91.518 N N N N
vg0139060178 C -> T LOC_Os01g67290.2 upstream_gene_variant ; 1649.0bp to feature; MODIFIER silent_mutation Average:79.066; most accessible tissue: Callus, score: 91.518 N N N N
vg0139060178 C -> T LOC_Os01g67290-LOC_Os01g67300 intergenic_region ; MODIFIER silent_mutation Average:79.066; most accessible tissue: Callus, score: 91.518 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0139060178 C T -0.01 -0.03 -0.03 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139060178 NA 1.31E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0139060178 NA 1.75E-06 mr1268 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 7.00E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 1.91E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 2.88E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 1.92E-09 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 3.97E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 1.15E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 8.30E-07 NA mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 7.46E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 1.88E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178 NA 2.03E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251