Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0139060178:

Variant ID: vg0139060178 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 39060178
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAGCCTAATTAATCCATAATTAGCACATGTTTACTGTAGTATCATATAGGCTAATCATAGATTAATTAGTCTCAATAAATTTGTCTCGCGAATTAGTC[C/T]
AGGTTATGGAATGAGTTTTATTATTAGTCTACATTTAATACCTATAATTAGTGTCCAAACATCCGATCTGATAGGGACTAAAATTTTAGTCCCTAATCCA

Reverse complement sequence

TGGATTAGGGACTAAAATTTTAGTCCCTATCAGATCGGATGTTTGGACACTAATTATAGGTATTAAATGTAGACTAATAATAAAACTCATTCCATAACCT[G/A]
GACTAATTCGCGAGACAAATTTATTGAGACTAATTAATCTATGATTAGCCTATATGATACTACAGTAAACATGTGCTAATTATGGATTAATTAGGCTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.60%	48.30%	0.11%	0.00%	NA
All Indica	2759	27.30%	72.60%	0.18%	0.00%	NA
All Japonica	1512	92.40%	7.60%	0.00%	0.00%	NA
Aus	269	85.50%	14.50%	0.00%	0.00%	NA
Indica I	595	61.50%	38.00%	0.50%	0.00%	NA
Indica II	465	4.30%	95.70%	0.00%	0.00%	NA
Indica III	913	15.80%	84.20%	0.00%	0.00%	NA
Indica Intermediate	786	28.20%	71.50%	0.25%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	83.70%	16.30%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139060178	C -> T	LOC_Os01g67290.1	upstream_gene_variant ; 1204.0bp to feature; MODIFIER	silent_mutation	Average:79.066; most accessible tissue: Callus, score: 91.518	N	N	N	N
vg0139060178	C -> T	LOC_Os01g67300.1	upstream_gene_variant ; 3319.0bp to feature; MODIFIER	silent_mutation	Average:79.066; most accessible tissue: Callus, score: 91.518	N	N	N	N
vg0139060178	C -> T	LOC_Os01g67290.2	upstream_gene_variant ; 1649.0bp to feature; MODIFIER	silent_mutation	Average:79.066; most accessible tissue: Callus, score: 91.518	N	N	N	N
vg0139060178	C -> T	LOC_Os01g67290-LOC_Os01g67300	intergenic_region ; MODIFIER	silent_mutation	Average:79.066; most accessible tissue: Callus, score: 91.518	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0139060178	C	T	-0.01	-0.03	-0.03	-0.01	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139060178	NA	1.31E-13	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0139060178	NA	1.75E-06	mr1268	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	7.00E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	1.91E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	2.88E-09	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	1.92E-09	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	3.97E-06	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	1.15E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	8.30E-07	NA	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	7.46E-10	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	1.88E-17	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139060178	NA	2.03E-06	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251