\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139005555:

Variant ID: vg0139005555 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39005555
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTGCGTGTAGAACTCCTGTATGAGAGATTTAATGTTCATGATGTGCCTTACTTTTTGTGCATATACTCAATCGGCCCCAGGTGCCACTTTTGTGGAA[A/T]
TTTTTTTATGAGTCGATGGTTGGATGAGGAAGATATATGGGGGAAAAAAAAGGTTAACAGACAAACTAAAATTGGTGTGCAACCTTTAGTTGAAAATGGA

Reverse complement sequence

TCCATTTTCAACTAAAGGTTGCACACCAATTTTAGTTTGTCTGTTAACCTTTTTTTTCCCCCATATATCTTCCTCATCCAACCATCGACTCATAAAAAAA[T/A]
TTCCACAAAAGTGGCACCTGGGGCCGATTGAGTATATGCACAAAAAGTAAGGCACATCATGAACATTAAATCTCTCATACAGGAGTTCTACACGCAGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 42.20% 0.66% 0.04% NA
All Indica  2759 91.10% 7.90% 0.94% 0.04% NA
All Japonica  1512 6.90% 92.90% 0.20% 0.00% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 89.20% 9.40% 1.34% 0.00% NA
Indica II  465 97.60% 1.70% 0.65% 0.00% NA
Indica III  913 90.30% 9.30% 0.33% 0.11% NA
Indica Intermediate  786 89.60% 8.90% 1.53% 0.00% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 15.10% 84.50% 0.40% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 41.10% 55.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139005555 A -> T LOC_Os01g67210.1 downstream_gene_variant ; 2652.0bp to feature; MODIFIER silent_mutation Average:79.144; most accessible tissue: Minghui63 flag leaf, score: 90.086 N N N N
vg0139005555 A -> T LOC_Os01g67220.1 intron_variant ; MODIFIER silent_mutation Average:79.144; most accessible tissue: Minghui63 flag leaf, score: 90.086 N N N N
vg0139005555 A -> T LOC_Os01g67220.2 intron_variant ; MODIFIER silent_mutation Average:79.144; most accessible tissue: Minghui63 flag leaf, score: 90.086 N N N N
vg0139005555 A -> T LOC_Os01g67220.3 intron_variant ; MODIFIER silent_mutation Average:79.144; most accessible tissue: Minghui63 flag leaf, score: 90.086 N N N N
vg0139005555 A -> DEL N N silent_mutation Average:79.144; most accessible tissue: Minghui63 flag leaf, score: 90.086 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139005555 NA 2.73E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 1.57E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 4.95E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 4.01E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 3.35E-58 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 1.12E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 2.89E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 2.35E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 1.51E-50 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 1.06E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 1.63E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 4.28E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 1.79E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 9.86E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 5.30E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 8.39E-06 NA mr1320_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 1.44E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 2.67E-49 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 1.26E-31 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139005555 NA 8.81E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251