\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138937464:

Variant ID: vg0138937464 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38937464
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAACACGTGAGGGAAAAATGTCAGAAAAAAGCACAAAAGAAAACGCGCTAGAAAATAAAGTTTCGTAGTTCTAATTTTCTGATTGTTATCGACATG[G/A]
TTATGCATGAAAAACGTATATTATCATTACGTTTTTTCACCCGTTGCAACGCACGGGCATATTTGCTAGTATAGAAAAAAAACTAATTACACCGATTAGA

Reverse complement sequence

TCTAATCGGTGTAATTAGTTTTTTTTCTATACTAGCAAATATGCCCGTGCGTTGCAACGGGTGAAAAAACGTAATGATAATATACGTTTTTCATGCATAA[C/T]
CATGTCGATAACAATCAGAAAATTAGAACTACGAAACTTTATTTTCTAGCGCGTTTTCTTTTGTGCTTTTTTCTGACATTTTTCCCTCACGTGTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.00% 6.50% 1.80% 68.71% NA
All Indica  2759 0.60% 0.20% 0.29% 98.88% NA
All Japonica  1512 69.20% 19.30% 3.84% 7.67% NA
Aus  269 0.00% 0.00% 4.09% 95.91% NA
Indica I  595 1.20% 0.20% 0.67% 97.98% NA
Indica II  465 0.90% 0.60% 0.22% 98.28% NA
Indica III  913 0.30% 0.10% 0.11% 99.45% NA
Indica Intermediate  786 0.40% 0.10% 0.25% 99.24% NA
Temperate Japonica  767 92.60% 0.90% 3.52% 3.00% NA
Tropical Japonica  504 40.50% 41.10% 3.97% 14.48% NA
Japonica Intermediate  241 54.80% 32.40% 4.56% 8.30% NA
VI/Aromatic  96 3.10% 0.00% 3.12% 93.75% NA
Intermediate  90 22.20% 11.10% 5.56% 61.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138937464 G -> A LOC_Os01g67054.1 upstream_gene_variant ; 2694.0bp to feature; MODIFIER silent_mutation Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0138937464 G -> A LOC_Os01g67070.1 upstream_gene_variant ; 1438.0bp to feature; MODIFIER silent_mutation Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0138937464 G -> A LOC_Os01g67054.3 upstream_gene_variant ; 2712.0bp to feature; MODIFIER silent_mutation Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0138937464 G -> A LOC_Os01g67054.2 upstream_gene_variant ; 2694.0bp to feature; MODIFIER silent_mutation Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0138937464 G -> A LOC_Os01g67054-LOC_Os01g67070 intergenic_region ; MODIFIER silent_mutation Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0138937464 G -> DEL N N silent_mutation Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138937464 NA 6.08E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 2.93E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 1.09E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 7.05E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 5.61E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 1.97E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 3.31E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 2.65E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 1.09E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 2.37E-07 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 3.21E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 9.40E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 6.98E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 5.48E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 9.22E-06 NA mr1482_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 6.10E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 1.19E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 2.22E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 1.14E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 6.53E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 5.92E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464 NA 1.81E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251