Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138937464:

Variant ID: vg0138937464 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 38937464
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAACACGTGAGGGAAAAATGTCAGAAAAAAGCACAAAAGAAAACGCGCTAGAAAATAAAGTTTCGTAGTTCTAATTTTCTGATTGTTATCGACATG[G/A]
TTATGCATGAAAAACGTATATTATCATTACGTTTTTTCACCCGTTGCAACGCACGGGCATATTTGCTAGTATAGAAAAAAAACTAATTACACCGATTAGA

Reverse complement sequence

TCTAATCGGTGTAATTAGTTTTTTTTCTATACTAGCAAATATGCCCGTGCGTTGCAACGGGTGAAAAAACGTAATGATAATATACGTTTTTCATGCATAA[C/T]
CATGTCGATAACAATCAGAAAATTAGAACTACGAAACTTTATTTTCTAGCGCGTTTTCTTTTGTGCTTTTTTCTGACATTTTTCCCTCACGTGTTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.00%	6.50%	1.80%	68.71%	NA
All Indica	2759	0.60%	0.20%	0.29%	98.88%	NA
All Japonica	1512	69.20%	19.30%	3.84%	7.67%	NA
Aus	269	0.00%	0.00%	4.09%	95.91%	NA
Indica I	595	1.20%	0.20%	0.67%	97.98%	NA
Indica II	465	0.90%	0.60%	0.22%	98.28%	NA
Indica III	913	0.30%	0.10%	0.11%	99.45%	NA
Indica Intermediate	786	0.40%	0.10%	0.25%	99.24%	NA
Temperate Japonica	767	92.60%	0.90%	3.52%	3.00%	NA
Tropical Japonica	504	40.50%	41.10%	3.97%	14.48%	NA
Japonica Intermediate	241	54.80%	32.40%	4.56%	8.30%	NA
VI/Aromatic	96	3.10%	0.00%	3.12%	93.75%	NA
Intermediate	90	22.20%	11.10%	5.56%	61.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0138937464	G -> A	LOC_Os01g67054.1	upstream_gene_variant ; 2694.0bp to feature; MODIFIER	silent_mutation	Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0138937464	G -> A	LOC_Os01g67070.1	upstream_gene_variant ; 1438.0bp to feature; MODIFIER	silent_mutation	Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0138937464	G -> A	LOC_Os01g67054.3	upstream_gene_variant ; 2712.0bp to feature; MODIFIER	silent_mutation	Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0138937464	G -> A	LOC_Os01g67054.2	upstream_gene_variant ; 2694.0bp to feature; MODIFIER	silent_mutation	Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0138937464	G -> A	LOC_Os01g67054-LOC_Os01g67070	intergenic_region ; MODIFIER	silent_mutation	Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0138937464	G -> DEL	N	N	silent_mutation	Average:26.003; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0138937464	NA	6.08E-08	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	2.93E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	1.09E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	7.05E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	5.61E-06	mr1088_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	1.97E-07	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	3.31E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	2.65E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	1.09E-06	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	2.37E-07	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	3.21E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	9.40E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	6.98E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	5.48E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	9.22E-06	NA	mr1482_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	6.10E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	1.19E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	2.22E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	1.14E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	6.53E-14	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	5.92E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138937464	NA	1.81E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251