\
| Variant ID: vg0138861491 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 38861491 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 57. )
AGATCTCTGCTCCTCCTAGAGTATAGTCCCGGTCCTCACCATTGACCAAGGCTGACCTCAAGTCACCTGCACACAATCAGACAAAACAACCGTTTCTGGG[C/T]
ACAGATATCACAACCTGACCCACATTAGTCACACACACTCACACCAACATTCACACATACTCTCAAACCAATTCTTTGATTAAATCATTTGCATAGCCAA
TTGGCTATGCAAATGATTTAATCAAAGAATTGGTTTGAGAGTATGTGTGAATGTTGGTGTGAGTGTGTGTGACTAATGTGGGTCAGGTTGTGATATCTGT[G/A]
CCCAGAAACGGTTGTTTTGTCTGATTGTGTGCAGGTGACTTGAGGTCAGCCTTGGTCAATGGTGAGGACCGGGACTATACTCTAGGAGGAGCAGAGATCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.70% | 2.80% | 17.60% | 38.98% | NA |
| All Indica | 2759 | 14.20% | 4.50% | 27.40% | 53.90% | NA |
| All Japonica | 1512 | 92.70% | 0.20% | 1.85% | 5.29% | NA |
| Aus | 269 | 3.70% | 0.00% | 8.92% | 87.36% | NA |
| Indica I | 595 | 13.60% | 0.50% | 18.32% | 67.56% | NA |
| Indica II | 465 | 10.30% | 5.20% | 13.55% | 70.97% | NA |
| Indica III | 913 | 18.10% | 6.50% | 43.04% | 32.42% | NA |
| Indica Intermediate | 786 | 12.30% | 5.00% | 24.30% | 58.40% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.65% | 2.22% | NA |
| Tropical Japonica | 504 | 85.50% | 0.40% | 4.17% | 9.92% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.40% | 0.83% | 5.39% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 9.38% | 15.62% | NA |
| Intermediate | 90 | 53.30% | 2.20% | 16.67% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0138861491 | C -> T | LOC_Os01g66910.1 | upstream_gene_variant ; 1277.0bp to feature; MODIFIER | silent_mutation | Average:45.092; most accessible tissue: Callus, score: 68.402 | N | N | N | N |
| vg0138861491 | C -> T | LOC_Os01g66920.1 | upstream_gene_variant ; 2529.0bp to feature; MODIFIER | silent_mutation | Average:45.092; most accessible tissue: Callus, score: 68.402 | N | N | N | N |
| vg0138861491 | C -> T | LOC_Os01g66910-LOC_Os01g66920 | intergenic_region ; MODIFIER | silent_mutation | Average:45.092; most accessible tissue: Callus, score: 68.402 | N | N | N | N |
| vg0138861491 | C -> DEL | N | N | silent_mutation | Average:45.092; most accessible tissue: Callus, score: 68.402 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0138861491 | NA | 5.81E-06 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138861491 | 5.35E-06 | 5.35E-06 | mr1799_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138861491 | NA | 7.39E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138861491 | 9.68E-07 | 9.72E-07 | mr1956_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138861491 | NA | 1.82E-06 | mr1956_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |