\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138726993:

Variant ID: vg0138726993 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38726993
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTAATTATATAAATAAAAGCTAATTCGGCGAGACAAATTTTTTAAGCCTAATTAATCTATAATTAGAGAATGTTTACTATAGCATCACATAGGCTAAT[T/C]
ATGGATTAGTTAGGCTTAATAAATTCGTCTCGCGAATTAGTCCAATATTATATATGTGTTTTATTAATAGTCTACGTTTAATATTTATAATTAGTGTATA

Reverse complement sequence

TATACACTAATTATAAATATTAAACGTAGACTATTAATAAAACACATATATAATATTGGACTAATTCGCGAGACGAATTTATTAAGCCTAACTAATCCAT[A/G]
ATTAGCCTATGTGATGCTATAGTAAACATTCTCTAATTATAGATTAATTAGGCTTAAAAAATTTGTCTCGCCGAATTAGCTTTTATTTATATAATTAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 34.60% 4.59% 6.22% NA
All Indica  2759 80.40% 2.20% 7.29% 10.08% NA
All Japonica  1512 2.80% 96.20% 0.46% 0.53% NA
Aus  269 97.80% 0.40% 0.74% 1.12% NA
Indica I  595 84.70% 1.30% 8.91% 5.04% NA
Indica II  465 58.50% 1.90% 16.13% 23.44% NA
Indica III  913 93.80% 0.40% 1.10% 4.71% NA
Indica Intermediate  786 74.70% 5.10% 8.02% 12.21% NA
Temperate Japonica  767 1.70% 96.90% 0.65% 0.78% NA
Tropical Japonica  504 3.80% 95.80% 0.20% 0.20% NA
Japonica Intermediate  241 4.60% 94.60% 0.41% 0.41% NA
VI/Aromatic  96 16.70% 82.30% 0.00% 1.04% NA
Intermediate  90 42.20% 45.60% 7.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138726993 T -> DEL N N silent_mutation Average:84.776; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0138726993 T -> C LOC_Os01g66670.1 upstream_gene_variant ; 2828.0bp to feature; MODIFIER silent_mutation Average:84.776; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0138726993 T -> C LOC_Os01g66680.1 upstream_gene_variant ; 2821.0bp to feature; MODIFIER silent_mutation Average:84.776; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0138726993 T -> C LOC_Os01g66670-LOC_Os01g66680 intergenic_region ; MODIFIER silent_mutation Average:84.776; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0138726993 T C 0.03 -0.08 -0.06 0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138726993 7.34E-07 4.94E-95 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 2.92E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 2.50E-09 9.41E-95 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 1.98E-06 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 2.62E-43 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 1.53E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 2.84E-06 2.16E-102 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 2.13E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 3.03E-91 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 4.18E-69 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 3.24E-06 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 1.38E-37 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 1.69E-06 6.14E-94 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 3.08E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 3.95E-08 5.59E-107 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 2.39E-12 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 1.03E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 1.07E-12 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 8.81E-10 8.18E-100 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 3.06E-06 4.90E-15 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 8.49E-103 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 1.47E-07 4.57E-54 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 1.35E-07 2.05E-127 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 6.11E-10 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 NA 8.41E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 3.62E-06 NA mr1946_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 4.37E-06 3.74E-09 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 3.62E-06 NA mr1948_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138726993 4.37E-06 3.74E-09 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251