\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138589406:

Variant ID: vg0138589406 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38589406
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.16, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCGAGGAATCTGCATATCGTCCAGGGTCTTAGCGAAAAGGATGTTGAGTGCACTGCCACCATCGATGAGAGTTCTTCGGAGCTTAACATTGCGAACCA[C/T]
TGGGTCTAGTACCAGGGGGTACCGCCCCGGGTGGACCACTCGGTCGGGATGATCCGAGCGGTCGAACTTGATTGCTATCTCTGACCACCGAAGGTATTGG

Reverse complement sequence

CCAATACCTTCGGTGGTCAGAGATAGCAATCAAGTTCGACCGCTCGGATCATCCCGACCGAGTGGTCCACCCGGGGCGGTACCCCCTGGTACTAGACCCA[G/A]
TGGTTCGCAATGTTAAGCTCCGAAGAACTCTCATCGATGGTGGCAGTGCACTCAACATCCTTTTCGCTAAGACCCTGGACGATATGCAGATTCCTCGCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.20% 0.55% 0.23% NA
All Indica  2759 41.00% 57.90% 0.76% 0.36% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 2.60% 96.70% 0.74% 0.00% NA
Indica I  595 33.30% 65.00% 1.18% 0.50% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 12.30% 87.10% 0.55% 0.11% NA
Indica Intermediate  786 47.70% 50.40% 1.15% 0.76% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 66.70% 1.04% 1.04% NA
Intermediate  90 75.60% 22.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138589406 C -> T LOC_Os01g66470.1 missense_variant ; p.Val721Met; MODERATE nonsynonymous_codon ; V721M Average:41.062; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 benign 1.053 TOLERATED 0.05
vg0138589406 C -> DEL LOC_Os01g66470.1 N frameshift_variant Average:41.062; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138589406 NA 3.26E-20 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138589406 NA 2.69E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138589406 NA 2.50E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 9.72E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 6.20E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 6.57E-07 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 8.95E-08 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 3.76E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 2.44E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 4.70E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 2.38E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 1.83E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 3.73E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 2.00E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 7.20E-07 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 9.66E-07 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 6.71E-13 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 4.17E-13 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 1.24E-07 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 4.54E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 1.20E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 6.15E-08 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 4.50E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 1.14E-07 mr1895_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 1.91E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406 NA 9.90E-08 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251