Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0138589406:

Variant ID: vg0138589406 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 38589406
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.16, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCGAGGAATCTGCATATCGTCCAGGGTCTTAGCGAAAAGGATGTTGAGTGCACTGCCACCATCGATGAGAGTTCTTCGGAGCTTAACATTGCGAACCA[C/T]
TGGGTCTAGTACCAGGGGGTACCGCCCCGGGTGGACCACTCGGTCGGGATGATCCGAGCGGTCGAACTTGATTGCTATCTCTGACCACCGAAGGTATTGG

Reverse complement sequence

CCAATACCTTCGGTGGTCAGAGATAGCAATCAAGTTCGACCGCTCGGATCATCCCGACCGAGTGGTCCACCCGGGGCGGTACCCCCTGGTACTAGACCCA[G/A]
TGGTTCGCAATGTTAAGCTCCGAAGAACTCTCATCGATGGTGGCAGTGCACTCAACATCCTTTTCGCTAAGACCCTGGACGATATGCAGATTCCTCGCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	41.20%	0.55%	0.23%	NA
All Indica	2759	41.00%	57.90%	0.76%	0.36%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	2.60%	96.70%	0.74%	0.00%	NA
Indica I	595	33.30%	65.00%	1.18%	0.50%	NA
Indica II	465	95.70%	4.30%	0.00%	0.00%	NA
Indica III	913	12.30%	87.10%	0.55%	0.11%	NA
Indica Intermediate	786	47.70%	50.40%	1.15%	0.76%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	66.70%	1.04%	1.04%	NA
Intermediate	90	75.60%	22.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0138589406	C -> T	LOC_Os01g66470.1	missense_variant ; p.Val721Met; MODERATE	nonsynonymous_codon ; V721M	Average:41.062; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	benign	1.053	TOLERATED	0.05
vg0138589406	C -> DEL	LOC_Os01g66470.1	N	frameshift_variant	Average:41.062; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0138589406	NA	3.26E-20	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138589406	NA	2.69E-14	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138589406	NA	2.50E-07	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	9.72E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	6.20E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	6.57E-07	mr1163	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	8.95E-08	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	3.76E-06	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	2.44E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	4.70E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	2.38E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	1.83E-09	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	3.73E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	2.00E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	7.20E-07	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	9.66E-07	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	6.71E-13	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	4.17E-13	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	1.24E-07	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	4.54E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	1.20E-10	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	6.15E-08	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	4.50E-09	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	1.14E-07	mr1895_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	1.91E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138589406	NA	9.90E-08	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251