\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138579441:

Variant ID: vg0138579441 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38579441
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGAGGAGATGGTGTTGTCGCTCTTTACTTTCTTTCCGATCTTGCCCCAGTTGATTGAACGGTCAGATTTCATTTAGTACTTGGAGGTACTAGTACCTT[G/A]
AGATACCAAGTGCTGGACCAGAGCAAAACTCATGAGAAAAATCAGAGGAGTTTTTGACAATGAGCGGTACCAAATCGTAGCCATCGATCTAGCGACATCG

Reverse complement sequence

CGATGTCGCTAGATCGATGGCTACGATTTGGTACCGCTCATTGTCAAAAACTCCTCTGATTTTTCTCATGAGTTTTGCTCTGGTCCAGCACTTGGTATCT[C/T]
AAGGTACTAGTACCTCCAAGTACTAAATGAAATCTGACCGTTCAATCAACTGGGGCAAGATCGGAAAGAAAGTAAAGAGCGACAACACCATCTCCTCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.80% 0.80% 0.40% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 96.40% 2.40% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 93.00% 4.70% 2.35% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138579441 G -> A LOC_Os01g66450.1 upstream_gene_variant ; 2966.0bp to feature; MODIFIER silent_mutation Average:58.548; most accessible tissue: Callus, score: 98.857 N N N N
vg0138579441 G -> A LOC_Os01g66440.1 intron_variant ; MODIFIER silent_mutation Average:58.548; most accessible tissue: Callus, score: 98.857 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138579441 9.39E-07 9.40E-07 mr1008 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138579441 1.73E-06 1.73E-06 mr1009 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138579441 5.37E-06 5.37E-06 mr1935 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251