Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0138579441:

Variant ID: vg0138579441 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 38579441
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGAGGAGATGGTGTTGTCGCTCTTTACTTTCTTTCCGATCTTGCCCCAGTTGATTGAACGGTCAGATTTCATTTAGTACTTGGAGGTACTAGTACCTT[G/A]
AGATACCAAGTGCTGGACCAGAGCAAAACTCATGAGAAAAATCAGAGGAGTTTTTGACAATGAGCGGTACCAAATCGTAGCCATCGATCTAGCGACATCG

Reverse complement sequence

CGATGTCGCTAGATCGATGGCTACGATTTGGTACCGCTCATTGTCAAAAACTCCTCTGATTTTTCTCATGAGTTTTGCTCTGGTCCAGCACTTGGTATCT[C/T]
AAGGTACTAGTACCTCCAAGTACTAAATGAAATCTGACCGTTCAATCAACTGGGGCAAGATCGGAAAGAAAGTAAAGAGCGACAACACCATCTCCTCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.80%	0.80%	0.40%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	96.40%	2.40%	1.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	93.00%	4.70%	2.35%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0138579441	G -> A	LOC_Os01g66450.1	upstream_gene_variant ; 2966.0bp to feature; MODIFIER	silent_mutation	Average:58.548; most accessible tissue: Callus, score: 98.857	N	N	N	N
vg0138579441	G -> A	LOC_Os01g66440.1	intron_variant ; MODIFIER	silent_mutation	Average:58.548; most accessible tissue: Callus, score: 98.857	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0138579441	9.39E-07	9.40E-07	mr1008	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138579441	1.73E-06	1.73E-06	mr1009	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138579441	5.37E-06	5.37E-06	mr1935	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251