\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138393950:

Variant ID: vg0138393950 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38393950
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATAGTCCCTCCGTCAAAAAAAAAAAGACAAACCTTGAGTTTCCGTGTTCAATTTTGACTGTTTGTCTTATATGAAATTTTTTTATAATTCGTATTTT[C/T]
ATTGTTGTTAGAAGATAAAACATGATTAATATTTTATGCGTGACTTATCTTTTTAATTTTTTTTATATTTTTTTTAAATAAGACGGATGGTCAAACGTTG

Reverse complement sequence

CAACGTTTGACCATCCGTCTTATTTAAAAAAAATATAAAAAAAATTAAAAAGATAAGTCACGCATAAAATATTAATCATGTTTTATCTTCTAACAACAAT[G/A]
AAAATACGAATTATAAAAAAATTTCATATAAGACAAACAGTCAAAATTGAACACGGAAACTCAAGGTTTGTCTTTTTTTTTTTGACGGAGGGACTATAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 34.70% 1.27% 0.00% NA
All Indica  2759 96.70% 1.80% 1.56% 0.00% NA
All Japonica  1512 3.40% 96.60% 0.07% 0.00% NA
Aus  269 94.80% 1.10% 4.09% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 97.70% 0.50% 1.75% 0.00% NA
Indica Intermediate  786 91.50% 5.20% 3.31% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.40% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 90.60% 4.17% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138393950 C -> T LOC_Os01g66110.1 upstream_gene_variant ; 2170.0bp to feature; MODIFIER silent_mutation Average:82.558; most accessible tissue: Minghui63 flower, score: 90.974 N N N N
vg0138393950 C -> T LOC_Os01g66110.2 upstream_gene_variant ; 2635.0bp to feature; MODIFIER silent_mutation Average:82.558; most accessible tissue: Minghui63 flower, score: 90.974 N N N N
vg0138393950 C -> T LOC_Os01g66120.1 downstream_gene_variant ; 4567.0bp to feature; MODIFIER silent_mutation Average:82.558; most accessible tissue: Minghui63 flower, score: 90.974 N N N N
vg0138393950 C -> T LOC_Os01g66120.3 downstream_gene_variant ; 4567.0bp to feature; MODIFIER silent_mutation Average:82.558; most accessible tissue: Minghui63 flower, score: 90.974 N N N N
vg0138393950 C -> T LOC_Os01g66110-LOC_Os01g66120 intergenic_region ; MODIFIER silent_mutation Average:82.558; most accessible tissue: Minghui63 flower, score: 90.974 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0138393950 C T 0.04 0.04 0.03 0.03 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138393950 NA 2.35E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 9.35E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 9.32E-19 7.03E-110 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 6.62E-08 1.12E-12 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 2.45E-20 3.86E-109 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 4.52E-07 9.24E-11 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 6.52E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 1.30E-06 8.09E-30 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 9.29E-17 7.49E-119 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 4.84E-07 1.58E-12 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 4.05E-97 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 2.91E-06 9.90E-77 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 5.51E-06 1.51E-09 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 2.19E-09 1.02E-44 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 1.71E-12 1.73E-106 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 8.37E-07 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 1.07E-06 NA mr1712 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 9.41E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 2.92E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 1.59E-16 1.16E-119 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 1.31E-11 2.03E-25 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 4.50E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 1.74E-15 5.39E-110 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 1.19E-13 3.83E-27 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 8.63E-09 2.37E-150 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 7.08E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 2.06E-09 7.17E-120 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 3.96E-11 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 1.84E-42 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 1.80E-11 1.97E-58 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 9.48E-15 1.77E-145 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 2.63E-13 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 1.21E-07 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138393950 NA 1.21E-07 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251