\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138205093:

Variant ID: vg0138205093 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38205093
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATAGAAATTCGGAATTAAAAAATAAGGAATATTAGAAGTAGAGTACAGAGTCTATATAGAAATACAATTAAGAAAAAAATAGAAATTCGGAATTAAAA[T/A]
AATAAGGAATATTAGAAGAAGAGTATAGAGTGAATTTAAAACTAACTAAAATTCAGAACAAACATAATAAAATTAAAAGTAGTGTTTAGAGTCCGTATAA

Reverse complement sequence

TTATACGGACTCTAAACACTACTTTTAATTTTATTATGTTTGTTCTGAATTTTAGTTAGTTTTAAATTCACTCTATACTCTTCTTCTAATATTCCTTATT[A/T]
TTTTAATTCCGAATTTCTATTTTTTTCTTAATTGTATTTCTATATAGACTCTGTACTCTACTTCTAATATTCCTTATTTTTTAATTCCGAATTTCTATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 35.00% 1.46% 1.88% NA
All Indica  2759 92.70% 2.00% 2.39% 2.94% NA
All Japonica  1512 3.50% 96.20% 0.07% 0.26% NA
Aus  269 97.00% 1.90% 0.00% 1.12% NA
Indica I  595 93.90% 0.20% 3.36% 2.52% NA
Indica II  465 87.30% 0.90% 3.66% 8.17% NA
Indica III  913 98.10% 0.80% 0.44% 0.66% NA
Indica Intermediate  786 88.50% 5.50% 3.18% 2.80% NA
Temperate Japonica  767 2.70% 97.10% 0.00% 0.13% NA
Tropical Japonica  504 3.80% 95.60% 0.20% 0.40% NA
Japonica Intermediate  241 5.40% 94.20% 0.00% 0.41% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 44.40% 52.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138205093 T -> A LOC_Os01g65780.1 downstream_gene_variant ; 2476.0bp to feature; MODIFIER silent_mutation Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0138205093 T -> A LOC_Os01g65790.1 downstream_gene_variant ; 1779.0bp to feature; MODIFIER silent_mutation Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0138205093 T -> A LOC_Os01g65780.4 downstream_gene_variant ; 2476.0bp to feature; MODIFIER silent_mutation Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0138205093 T -> A LOC_Os01g65780.2 downstream_gene_variant ; 2476.0bp to feature; MODIFIER silent_mutation Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0138205093 T -> A LOC_Os01g65780.3 downstream_gene_variant ; 2476.0bp to feature; MODIFIER silent_mutation Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0138205093 T -> A LOC_Os01g65780-LOC_Os01g65790 intergenic_region ; MODIFIER silent_mutation Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0138205093 T -> DEL N N silent_mutation Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138205093 NA 5.50E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 7.55E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 2.25E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 1.97E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 1.56E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 3.39E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 4.67E-24 5.11E-115 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 6.62E-08 1.12E-12 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 4.46E-23 9.06E-113 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 4.52E-07 9.24E-11 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 3.31E-45 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 3.72E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 5.36E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 1.41E-06 2.40E-31 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 4.68E-21 2.07E-125 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 4.84E-07 1.58E-12 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 3.69E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 9.61E-10 1.23E-105 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 5.46E-09 1.33E-81 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 5.51E-06 1.51E-09 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 1.55E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 4.59E-12 7.79E-48 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 3.06E-18 1.56E-114 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 8.37E-07 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 7.11E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 6.16E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 8.27E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 2.66E-81 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 1.11E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 2.06E-24 9.91E-128 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 1.31E-11 2.03E-25 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 4.92E-39 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 1.06E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 4.44E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 1.11E-15 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 1.17E-19 4.00E-117 mr1504_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 1.19E-13 3.83E-27 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 2.56E-11 1.26E-158 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 7.08E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 1.82E-10 2.02E-124 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 3.96E-11 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 3.35E-42 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 2.96E-15 2.19E-63 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 1.68E-22 6.85E-159 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 2.63E-13 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 6.32E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 1.21E-07 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138205093 NA 1.21E-07 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251