\
| Variant ID: vg0138205093 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 38205093 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATAGAAATTCGGAATTAAAAAATAAGGAATATTAGAAGTAGAGTACAGAGTCTATATAGAAATACAATTAAGAAAAAAATAGAAATTCGGAATTAAAA[T/A]
AATAAGGAATATTAGAAGAAGAGTATAGAGTGAATTTAAAACTAACTAAAATTCAGAACAAACATAATAAAATTAAAAGTAGTGTTTAGAGTCCGTATAA
TTATACGGACTCTAAACACTACTTTTAATTTTATTATGTTTGTTCTGAATTTTAGTTAGTTTTAAATTCACTCTATACTCTTCTTCTAATATTCCTTATT[A/T]
TTTTAATTCCGAATTTCTATTTTTTTCTTAATTGTATTTCTATATAGACTCTGTACTCTACTTCTAATATTCCTTATTTTTTAATTCCGAATTTCTATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 35.00% | 1.46% | 1.88% | NA |
| All Indica | 2759 | 92.70% | 2.00% | 2.39% | 2.94% | NA |
| All Japonica | 1512 | 3.50% | 96.20% | 0.07% | 0.26% | NA |
| Aus | 269 | 97.00% | 1.90% | 0.00% | 1.12% | NA |
| Indica I | 595 | 93.90% | 0.20% | 3.36% | 2.52% | NA |
| Indica II | 465 | 87.30% | 0.90% | 3.66% | 8.17% | NA |
| Indica III | 913 | 98.10% | 0.80% | 0.44% | 0.66% | NA |
| Indica Intermediate | 786 | 88.50% | 5.50% | 3.18% | 2.80% | NA |
| Temperate Japonica | 767 | 2.70% | 97.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 3.80% | 95.60% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 52.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0138205093 | T -> A | LOC_Os01g65780.1 | downstream_gene_variant ; 2476.0bp to feature; MODIFIER | silent_mutation | Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0138205093 | T -> A | LOC_Os01g65790.1 | downstream_gene_variant ; 1779.0bp to feature; MODIFIER | silent_mutation | Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0138205093 | T -> A | LOC_Os01g65780.4 | downstream_gene_variant ; 2476.0bp to feature; MODIFIER | silent_mutation | Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0138205093 | T -> A | LOC_Os01g65780.2 | downstream_gene_variant ; 2476.0bp to feature; MODIFIER | silent_mutation | Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0138205093 | T -> A | LOC_Os01g65780.3 | downstream_gene_variant ; 2476.0bp to feature; MODIFIER | silent_mutation | Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0138205093 | T -> A | LOC_Os01g65780-LOC_Os01g65790 | intergenic_region ; MODIFIER | silent_mutation | Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0138205093 | T -> DEL | N | N | silent_mutation | Average:34.453; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0138205093 | NA | 5.50E-27 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 7.55E-67 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 2.25E-10 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 1.97E-31 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 1.56E-44 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 3.39E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 4.67E-24 | 5.11E-115 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 6.62E-08 | 1.12E-12 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 4.46E-23 | 9.06E-113 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 4.52E-07 | 9.24E-11 | mr1135 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 3.31E-45 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 3.72E-43 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 5.36E-27 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 1.41E-06 | 2.40E-31 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 4.68E-21 | 2.07E-125 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 4.84E-07 | 1.58E-12 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 3.69E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 9.61E-10 | 1.23E-105 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 5.46E-09 | 1.33E-81 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 5.51E-06 | 1.51E-09 | mr1538 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 1.55E-19 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 4.59E-12 | 7.79E-48 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 3.06E-18 | 1.56E-114 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 8.37E-07 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 7.11E-35 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 6.16E-19 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 8.27E-39 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 2.66E-81 | mr1027_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 1.11E-12 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 2.06E-24 | 9.91E-128 | mr1134_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 1.31E-11 | 2.03E-25 | mr1134_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 4.92E-39 | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 1.06E-08 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 4.44E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 1.11E-15 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 1.17E-19 | 4.00E-117 | mr1504_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 1.19E-13 | 3.83E-27 | mr1504_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 2.56E-11 | 1.26E-158 | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 7.08E-07 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 1.82E-10 | 2.02E-124 | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 3.96E-11 | mr1538_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 3.35E-42 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 2.96E-15 | 2.19E-63 | mr1670_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | 1.68E-22 | 6.85E-159 | mr1672_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 2.63E-13 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 6.32E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 1.21E-07 | mr1946_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138205093 | NA | 1.21E-07 | mr1948_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |