\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138169040:

Variant ID: vg0138169040 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38169040
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACTCGCCCTTGACCGTGGGCACGGCTGTTCGAACAGTTCATTAATCTCTGCAGAGGTTGCACGCTTTACCCACACGACACGAAACTGACATTGTTTAC[C/T]
CGTCAGCAACGAAAGTTCGTGATAAGGCCTTTCCAAAGCTAACCCATGAAAATCGCATGCCACCTAGTTGGGCTAAAATCCATAGCCGAGTATCAGGCAA

Reverse complement sequence

TTGCCTGATACTCGGCTATGGATTTTAGCCCAACTAGGTGGCATGCGATTTTCATGGGTTAGCTTTGGAAAGGCCTTATCACGAACTTTCGTTGCTGACG[G/A]
GTAAACAATGTCAGTTTCGTGTCGTGTGGGTAAAGCGTGCAACCTCTGCAGAGATTAATGAACTGTTCGAACAGCCGTGCCCACGGTCAAGGGCGAGTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.40% 0.11% 0.00% NA
All Indica  2759 96.20% 3.70% 0.11% 0.00% NA
All Japonica  1512 3.00% 97.00% 0.07% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.00% 0.38% 0.00% NA
Temperate Japonica  767 2.70% 97.10% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138169040 C -> T LOC_Os01g65740.1 downstream_gene_variant ; 1895.0bp to feature; MODIFIER silent_mutation Average:49.596; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0138169040 C -> T LOC_Os01g65750.1 downstream_gene_variant ; 696.0bp to feature; MODIFIER silent_mutation Average:49.596; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0138169040 C -> T LOC_Os01g65760.1 downstream_gene_variant ; 3730.0bp to feature; MODIFIER silent_mutation Average:49.596; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0138169040 C -> T LOC_Os01g65740-LOC_Os01g65750 intergenic_region ; MODIFIER silent_mutation Average:49.596; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138169040 1.99E-08 1.95E-13 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 6.28E-07 1.41E-10 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 NA 3.84E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 3.09E-06 3.09E-06 mr1375 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 6.47E-07 2.51E-12 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 1.36E-06 7.62E-10 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 NA 1.30E-36 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 5.03E-06 NA mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 NA 1.81E-07 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 5.14E-13 1.77E-27 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 1.47E-14 7.90E-29 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 NA 1.23E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 8.89E-06 5.54E-11 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 2.71E-06 8.61E-49 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 9.86E-08 9.86E-08 mr1670_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 8.74E-06 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 NA 3.13E-14 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 NA 2.37E-07 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169040 NA 2.37E-07 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251