\
| Variant ID: vg0138169040 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 38169040 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATACTCGCCCTTGACCGTGGGCACGGCTGTTCGAACAGTTCATTAATCTCTGCAGAGGTTGCACGCTTTACCCACACGACACGAAACTGACATTGTTTAC[C/T]
CGTCAGCAACGAAAGTTCGTGATAAGGCCTTTCCAAAGCTAACCCATGAAAATCGCATGCCACCTAGTTGGGCTAAAATCCATAGCCGAGTATCAGGCAA
TTGCCTGATACTCGGCTATGGATTTTAGCCCAACTAGGTGGCATGCGATTTTCATGGGTTAGCTTTGGAAAGGCCTTATCACGAACTTTCGTTGCTGACG[G/A]
GTAAACAATGTCAGTTTCGTGTCGTGTGGGTAAAGCGTGCAACCTCTGCAGAGATTAATGAACTGTTCGAACAGCCGTGCCCACGGTCAAGGGCGAGTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.50% | 36.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 96.20% | 3.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 3.00% | 97.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.60% | 8.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 53.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0138169040 | C -> T | LOC_Os01g65740.1 | downstream_gene_variant ; 1895.0bp to feature; MODIFIER | silent_mutation | Average:49.596; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0138169040 | C -> T | LOC_Os01g65750.1 | downstream_gene_variant ; 696.0bp to feature; MODIFIER | silent_mutation | Average:49.596; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0138169040 | C -> T | LOC_Os01g65760.1 | downstream_gene_variant ; 3730.0bp to feature; MODIFIER | silent_mutation | Average:49.596; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0138169040 | C -> T | LOC_Os01g65740-LOC_Os01g65750 | intergenic_region ; MODIFIER | silent_mutation | Average:49.596; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0138169040 | 1.99E-08 | 1.95E-13 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 6.28E-07 | 1.41E-10 | mr1135 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | NA | 3.84E-24 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 3.09E-06 | 3.09E-06 | mr1375 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 6.47E-07 | 2.51E-12 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 1.36E-06 | 7.62E-10 | mr1538 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | NA | 1.30E-36 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 5.03E-06 | NA | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | NA | 1.81E-07 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 5.14E-13 | 1.77E-27 | mr1134_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 1.47E-14 | 7.90E-29 | mr1504_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | NA | 1.23E-06 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 8.89E-06 | 5.54E-11 | mr1538_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 2.71E-06 | 8.61E-49 | mr1670_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 9.86E-08 | 9.86E-08 | mr1670_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | 8.74E-06 | NA | mr1672_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | NA | 3.13E-14 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | NA | 2.37E-07 | mr1946_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138169040 | NA | 2.37E-07 | mr1948_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |