Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138161332:

Variant ID: vg0138161332 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 38161332
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATATAGAATTCTAACATGAATGTAAGTGTAAAACAGAGAAGCAAAACACAGGAAAAACGTAGGAATGACCGTTTGATTGGACCACAGGAAAAACTGA[G/T]
GAATTTGAGGAGAGATAAAGACTCAAAGGATTTTTCCATGAGGTTCTACCTCTTGTTAAAATTCCTCCAAAACTTGAAATTCATAGGGTTCATTTCTTTG

Reverse complement sequence

CAAAGAAATGAACCCTATGAATTTCAAGTTTTGGAGGAATTTTAACAAGAGGTAGAACCTCATGGAAAAATCCTTTGAGTCTTTATCTCTCCTCAAATTC[C/A]
TCAGTTTTTCCTGTGGTCCAATCAAACGGTCATTCCTACGTTTTTCCTGTGTTTTGCTTCTCTGTTTTACACTTACATTCATGTTAGAATTCTATATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.90%	0.00%	0.00%	NA
All Indica	2759	97.10%	2.90%	0.00%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	29.70%	70.30%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.30%	3.70%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0138161332	G -> T	LOC_Os01g65730.1	upstream_gene_variant ; 1547.0bp to feature; MODIFIER	silent_mutation	Average:29.571; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0138161332	G -> T	LOC_Os01g65740.1	upstream_gene_variant ; 3205.0bp to feature; MODIFIER	silent_mutation	Average:29.571; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0138161332	G -> T	LOC_Os01g65720.1	downstream_gene_variant ; 4221.0bp to feature; MODIFIER	silent_mutation	Average:29.571; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0138161332	G -> T	LOC_Os01g65730-LOC_Os01g65740	intergenic_region ; MODIFIER	silent_mutation	Average:29.571; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0138161332	NA	3.30E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	7.22E-07	NA	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	5.52E-07	NA	mr1135	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	1.91E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	5.03E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	2.43E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	1.04E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	2.91E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	2.42E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	3.16E-09	NA	mr1504	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	2.91E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	4.03E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	1.47E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	3.33E-11	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	1.05E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	7.24E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	7.08E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	1.28E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138161332	NA	1.76E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251