\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138160627:

Variant ID: vg0138160627 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38160627
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.08, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAAAACACAGCACAGGTTGAGGTAGTACTCGTATTTGTTTCGCTGTCTTTCGCTTTGCTGGTTGGTTCGTACTGCAAACTTGAACTCACACCACAGGT[G/T]
GTGGCTTTAACTAATGCCGTGCATCAGTTGAACAAGCATAGAGTAGTTCGCTTGCTCTTCAGCTTGTCGGCCGCAATTGAAATTTAAATTTTAAATCTTA

Reverse complement sequence

TAAGATTTAAAATTTAAATTTCAATTGCGGCCGACAAGCTGAAGAGCAAGCGAACTACTCTATGCTTGTTCAACTGATGCACGGCATTAGTTAAAGCCAC[C/A]
ACCTGTGGTGTGAGTTCAAGTTTGCAGTACGAACCAACCAGCAAAGCGAAAGACAGCGAAACAAATACGAGTACTACCTCAACCTGTGCTGTGTTTTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.90% 0.02% 0.00% NA
All Indica  2759 97.10% 2.80% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 29.70% 70.30% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.30% 3.60% 0.11% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138160627 G -> T LOC_Os01g65730.1 upstream_gene_variant ; 842.0bp to feature; MODIFIER silent_mutation Average:82.87; most accessible tissue: Minghui63 flower, score: 88.293 N N N N
vg0138160627 G -> T LOC_Os01g65740.1 upstream_gene_variant ; 3910.0bp to feature; MODIFIER silent_mutation Average:82.87; most accessible tissue: Minghui63 flower, score: 88.293 N N N N
vg0138160627 G -> T LOC_Os01g65720.1 downstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:82.87; most accessible tissue: Minghui63 flower, score: 88.293 N N N N
vg0138160627 G -> T LOC_Os01g65730-LOC_Os01g65740 intergenic_region ; MODIFIER silent_mutation Average:82.87; most accessible tissue: Minghui63 flower, score: 88.293 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0138160627 G T -0.01 0.01 0.0 -0.03 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138160627 NA 9.35E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 2.76E-07 NA mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 1.91E-06 NA mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 7.03E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 8.09E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 3.36E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 1.43E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 4.49E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 4.67E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 2.98E-09 NA mr1504 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 4.49E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 5.27E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 1.11E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 1.14E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 2.68E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 1.43E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138160627 NA 4.72E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251