Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138147992:

Variant ID: vg0138147992 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 38147992
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGTAGGTTAAGAAGCAATAGGGTTATTTTTTGAAATGGACTTCTTAACCAACCTCAAGCGAAAACGGATTTTCACTTGTGGTCCTAGACTCACCGTCGG[C/T]
GAAAATGAATTTTCACTAACGGTTCTAAACCCTCTATTCCTCGTTAGAATTTCACAAGCGGATTTCTTATATGACCGCTAGCTAAAAAAATAGAGTACCG

Reverse complement sequence

CGGTACTCTATTTTTTTAGCTAGCGGTCATATAAGAAATCCGCTTGTGAAATTCTAACGAGGAATAGAGGGTTTAGAACCGTTAGTGAAAATTCATTTTC[G/A]
CCGACGGTGAGTCTAGGACCACAAGTGAAAATCCGTTTTCGCTTGAGGTTGGTTAAGAAGTCCATTTCAAAAAATAACCCTATTGCTTCTTAACCTACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	5.50%	0.02%	0.00%	NA
All Indica	2759	97.20%	2.70%	0.04%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.50%	3.40%	0.11%	0.00%	NA
Indica Intermediate	786	95.30%	4.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0138147992	C -> T	LOC_Os01g65692.1	5_prime_UTR_variant ; 227.0bp to feature; MODIFIER	silent_mutation	Average:60.385; most accessible tissue: Callus, score: 98.023	N	N	N	N
vg0138147992	C -> T	LOC_Os01g65690.1	upstream_gene_variant ; 1847.0bp to feature; MODIFIER	silent_mutation	Average:60.385; most accessible tissue: Callus, score: 98.023	N	N	N	N
vg0138147992	C -> T	LOC_Os01g65700.1	upstream_gene_variant ; 692.0bp to feature; MODIFIER	silent_mutation	Average:60.385; most accessible tissue: Callus, score: 98.023	N	N	N	N
vg0138147992	C -> T	LOC_Os01g65710.1	upstream_gene_variant ; 3373.0bp to feature; MODIFIER	silent_mutation	Average:60.385; most accessible tissue: Callus, score: 98.023	N	N	N	N
vg0138147992	C -> T	LOC_Os01g65690.2	upstream_gene_variant ; 1847.0bp to feature; MODIFIER	silent_mutation	Average:60.385; most accessible tissue: Callus, score: 98.023	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0138147992	NA	9.29E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	2.67E-07	NA	mr1134	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	1.88E-06	NA	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	6.74E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	8.22E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	3.15E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	1.37E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	4.77E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	4.60E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	3.34E-09	NA	mr1504	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	4.77E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	5.32E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	1.19E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	9.92E-12	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	2.74E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	1.63E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138147992	NA	4.94E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251