\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138058961:

Variant ID: vg0138058961 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38058961
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGTAATGGCTACTGCAGTGTCACCATGTGAAATACATCCAAACTTATCTTTCATTTGCAGCACTCAACTTTTTTTATGCTTGTTGTGTGATATTTTTT[T/A]
AAAAAAATATATACCGCGAATTTAAACCATGAAATCAAAATGTCAATAAGTATATGGGGGTTGGTACCTAAAATATTTTTTCCCTGTATTTGAAAGGTAT

Reverse complement sequence

ATACCTTTCAAATACAGGGAAAAAATATTTTAGGTACCAACCCCCATATACTTATTGACATTTTGATTTCATGGTTTAAATTCGCGGTATATATTTTTTT[A/T]
AAAAAATATCACACAACAAGCATAAAAAAAGTTGAGTGCTGCAAATGAAAGATAAGTTTGGATGTATTTCACATGGTGACACTGCAGTAGCCATTACATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 32.40% 1.63% 0.00% NA
All Indica  2759 97.00% 2.80% 0.25% 0.00% NA
All Japonica  1512 9.10% 86.40% 4.50% 0.00% NA
Aus  269 95.20% 4.50% 0.37% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 98.70% 0.90% 0.43% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 92.00% 7.40% 0.64% 0.00% NA
Temperate Japonica  767 14.00% 77.40% 8.60% 0.00% NA
Tropical Japonica  504 3.60% 96.20% 0.20% 0.00% NA
Japonica Intermediate  241 5.40% 94.20% 0.41% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138058961 T -> A LOC_Os01g65560.1 upstream_gene_variant ; 1119.0bp to feature; MODIFIER silent_mutation Average:77.882; most accessible tissue: Minghui63 flower, score: 88.913 N N N N
vg0138058961 T -> A LOC_Os01g65550.1 downstream_gene_variant ; 4604.0bp to feature; MODIFIER silent_mutation Average:77.882; most accessible tissue: Minghui63 flower, score: 88.913 N N N N
vg0138058961 T -> A LOC_Os01g65550.2 downstream_gene_variant ; 4604.0bp to feature; MODIFIER silent_mutation Average:77.882; most accessible tissue: Minghui63 flower, score: 88.913 N N N N
vg0138058961 T -> A LOC_Os01g65560-LOC_Os01g65580 intergenic_region ; MODIFIER silent_mutation Average:77.882; most accessible tissue: Minghui63 flower, score: 88.913 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0138058961 T A 0.0 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138058961 1.35E-06 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138058961 NA 1.14E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138058961 2.17E-06 NA mr1446 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251