\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137912344:

Variant ID: vg0137912344 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37912344
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAAGTTGTTTTAAATAAAAATAGTTGCATATTATGATAGTTTGTTTAATGATAAATCTAGTAACATCAATTTTATATGATTGATATTTATTATTATTA[A/T]
TAGTTAAAATTAAAAAATGTTTGACTTGTCATTATAGTAAAAATGCTTATATTTTGGGACGGAAGGAGTATGTTCTATATTAAAAAAAGGTATATTAAAT

Reverse complement sequence

ATTTAATATACCTTTTTTTAATATAGAACATACTCCTTCCGTCCCAAAATATAAGCATTTTTACTATAATGACAAGTCAAACATTTTTTAATTTTAACTA[T/A]
TAATAATAATAAATATCAATCATATAAAATTGATGTTACTAGATTTATCATTAAACAAACTATCATAATATGCAACTATTTTTATTTAAAACAACTTACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 6.00% 0.06% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 98.00% 1.80% 0.20% 0.00% NA
Aus  269 29.70% 70.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 8.70% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137912344 A -> T LOC_Os01g65340.1 downstream_gene_variant ; 988.0bp to feature; MODIFIER silent_mutation Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822 N N N N
vg0137912344 A -> T LOC_Os01g65350.1 downstream_gene_variant ; 2413.0bp to feature; MODIFIER silent_mutation Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822 N N N N
vg0137912344 A -> T LOC_Os01g65350.2 downstream_gene_variant ; 2417.0bp to feature; MODIFIER silent_mutation Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822 N N N N
vg0137912344 A -> T LOC_Os01g65340-LOC_Os01g65350 intergenic_region ; MODIFIER silent_mutation Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137912344 NA 1.11E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 1.68E-19 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 2.24E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 1.87E-23 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 1.22E-06 NA mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 7.94E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 5.61E-15 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 7.94E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 1.89E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 1.78E-18 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344 NA 7.68E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251