Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137912344:

Variant ID: vg0137912344 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37912344
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTAAGTTGTTTTAAATAAAAATAGTTGCATATTATGATAGTTTGTTTAATGATAAATCTAGTAACATCAATTTTATATGATTGATATTTATTATTATTA[A/T]
TAGTTAAAATTAAAAAATGTTTGACTTGTCATTATAGTAAAAATGCTTATATTTTGGGACGGAAGGAGTATGTTCTATATTAAAAAAAGGTATATTAAAT

Reverse complement sequence

ATTTAATATACCTTTTTTTAATATAGAACATACTCCTTCCGTCCCAAAATATAAGCATTTTTACTATAATGACAAGTCAAACATTTTTTAATTTTAACTA[T/A]
TAATAATAATAAATATCAATCATATAAAATTGATGTTACTAGATTTATCATTAAACAAACTATCATAATATGCAACTATTTTTATTTAAAACAACTTACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.00%	6.00%	0.06%	0.00%	NA
All Indica	2759	97.80%	2.20%	0.00%	0.00%	NA
All Japonica	1512	98.00%	1.80%	0.20%	0.00%	NA
Aus	269	29.70%	70.30%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.30%	3.70%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	3.30%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	90.00%	8.70%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137912344	A -> T	LOC_Os01g65340.1	downstream_gene_variant ; 988.0bp to feature; MODIFIER	silent_mutation	Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822	N	N	N	N
vg0137912344	A -> T	LOC_Os01g65350.1	downstream_gene_variant ; 2413.0bp to feature; MODIFIER	silent_mutation	Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822	N	N	N	N
vg0137912344	A -> T	LOC_Os01g65350.2	downstream_gene_variant ; 2417.0bp to feature; MODIFIER	silent_mutation	Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822	N	N	N	N
vg0137912344	A -> T	LOC_Os01g65340-LOC_Os01g65350	intergenic_region ; MODIFIER	silent_mutation	Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137912344	NA	1.11E-18	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	1.68E-19	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	2.24E-16	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	1.87E-23	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	1.22E-06	NA	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	7.94E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	5.61E-15	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	7.94E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	1.89E-11	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	1.78E-18	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137912344	NA	7.68E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251