\
| Variant ID: vg0137912344 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37912344 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTAAGTTGTTTTAAATAAAAATAGTTGCATATTATGATAGTTTGTTTAATGATAAATCTAGTAACATCAATTTTATATGATTGATATTTATTATTATTA[A/T]
TAGTTAAAATTAAAAAATGTTTGACTTGTCATTATAGTAAAAATGCTTATATTTTGGGACGGAAGGAGTATGTTCTATATTAAAAAAAGGTATATTAAAT
ATTTAATATACCTTTTTTTAATATAGAACATACTCCTTCCGTCCCAAAATATAAGCATTTTTACTATAATGACAAGTCAAACATTTTTTAATTTTAACTA[T/A]
TAATAATAATAAATATCAATCATATAAAATTGATGTTACTAGATTTATCATTAAACAAACTATCATAATATGCAACTATTTTTATTTAAAACAACTTACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 6.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.00% | 1.80% | 0.20% | 0.00% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 8.70% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137912344 | A -> T | LOC_Os01g65340.1 | downstream_gene_variant ; 988.0bp to feature; MODIFIER | silent_mutation | Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822 | N | N | N | N |
| vg0137912344 | A -> T | LOC_Os01g65350.1 | downstream_gene_variant ; 2413.0bp to feature; MODIFIER | silent_mutation | Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822 | N | N | N | N |
| vg0137912344 | A -> T | LOC_Os01g65350.2 | downstream_gene_variant ; 2417.0bp to feature; MODIFIER | silent_mutation | Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822 | N | N | N | N |
| vg0137912344 | A -> T | LOC_Os01g65340-LOC_Os01g65350 | intergenic_region ; MODIFIER | silent_mutation | Average:58.594; most accessible tissue: Zhenshan97 root, score: 87.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137912344 | NA | 1.11E-18 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 1.68E-19 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 2.24E-16 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 1.87E-23 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | 1.22E-06 | NA | mr1163 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 7.94E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 5.61E-15 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 7.94E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 1.89E-11 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 1.78E-18 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137912344 | NA | 7.68E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |