\
| Variant ID: vg0137881863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37881863 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.24, others allele: 0.00, population size: 313. )
CCCAGTCGGCATCCGAGTAAGCGGTGAGCTCGTGTGGCGACGAAGCCGACAGAAGTATGCCGTGACAAAGTGTACCTTCGATATAGCGAAGAACTCGCTT[C/T]
ACCAGGTTCAAGTGACCTTCACGTGGATCATGCATGTGTAGACATATTTGTTGTACTGCATATGCTATGTCTGGCCTTGTGAATGTCAGATATTGGAGAG
CTCTCCAATATCTGACATTCACAAGGCCAGACATAGCATATGCAGTACAACAAATATGTCTACACATGCATGATCCACGTGAAGGTCACTTGAACCTGGT[G/A]
AAGCGAGTTCTTCGCTATATCGAAGGTACACTTTGTCACGGCATACTTCTGTCGGCTTCGTCGCCACACGAGCTCACCGCTTACTCGGATGCCGACTGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.60% | 23.00% | 0.02% | 0.38% | NA |
| All Indica | 2759 | 67.50% | 31.90% | 0.04% | 0.62% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.40% | 70.30% | 0.00% | 0.37% | NA |
| Indica I | 595 | 63.70% | 35.60% | 0.00% | 0.67% | NA |
| Indica II | 465 | 85.40% | 13.50% | 0.00% | 1.08% | NA |
| Indica III | 913 | 54.80% | 44.90% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 74.40% | 24.80% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137881863 | C -> T | LOC_Os01g65290.1 | synonymous_variant ; p.Val273Val; LOW | synonymous_codon | Average:64.053; most accessible tissue: Minghui63 flower, score: 84.277 | N | N | N | N |
| vg0137881863 | C -> DEL | LOC_Os01g65290.1 | N | frameshift_variant | Average:64.053; most accessible tissue: Minghui63 flower, score: 84.277 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137881863 | NA | 6.62E-07 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | 4.70E-09 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | 1.57E-15 | 2.22E-17 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | 2.23E-08 | NA | mr1538 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | 2.73E-12 | 1.41E-13 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | NA | 6.86E-06 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | 4.97E-10 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | 3.89E-16 | 1.97E-16 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | 1.21E-07 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137881863 | 2.49E-12 | 4.11E-16 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |