\
| Variant ID: vg0137855094 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37855094 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 309. )
TCATCTGAGAAGTACTCAGGAATTTTGAGATCGCGTGCTATAATTCTCTGGAAAATTAACCACTCACTGGCATCTTTAAATGGTGAAGAGCCAGAAAGCA[A/T]
TTGATATAGAGTACACCCCAATGCCCATAAGTCATTTCTGTCAAGAACAGATAAAGGTTCATCAGAGAAATTATGTATAAAGATATCATAATAACTCATA
TATGAGTTATTATGATATCTTTATACATAATTTCTCTGATGAACCTTTATCTGTTCTTGACAGAAATGACTTATGGGCATTGGGGTGTACTCTATATCAA[T/A]
TGCTTTCTGGCTCTTCACCATTTAAAGATGCCAGTGAGTGGTTAATTTTCCAGAGAATTATAGCACGCGATCTCAAAATTCCTGAGTACTTCTCAGATGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 35.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137855094 | A -> T | LOC_Os01g65230.1 | missense_variant ; p.Leu251Met; MODERATE | nonsynonymous_codon ; L251M | Average:51.231; most accessible tissue: Zhenshan97 panicle, score: 61.671 | benign |
-0.484 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137855094 | NA | 4.12E-112 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 5.67E-110 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 3.76E-74 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.66E-79 | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.24E-27 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.65E-68 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 5.60E-32 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.05E-45 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.41E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.25E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 8.62E-26 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 7.29E-13 | 2.14E-106 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 3.33E-06 | 3.62E-10 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 3.75E-14 | 9.17E-104 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 4.70E-09 | mr1135 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.06E-46 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.80E-52 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 6.09E-44 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 3.34E-29 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 8.08E-11 | 6.25E-34 | mr1375 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 4.76E-10 | 4.76E-10 | mr1375 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 3.95E-12 | 1.45E-116 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 9.59E-10 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 8.50E-18 | 9.93E-119 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 3.75E-07 | 7.03E-09 | mr1517 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 1.28E-18 | 2.92E-92 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 1.68E-12 | 5.17E-18 | mr1538 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 9.72E-21 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 6.41E-42 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.16E-58 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 5.65E-40 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.67E-32 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 2.11E-06 | 1.15E-42 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 4.18E-12 | 3.83E-107 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 7.00E-36 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.29E-30 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 4.92E-19 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.93E-89 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 8.45E-42 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.14E-102 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 6.43E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.22E-111 | mr1008_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.39E-86 | mr1015_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 4.96E-24 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 8.59E-83 | mr1027_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.53E-27 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 3.15E-32 | mr1081_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.61E-40 | mr1092_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 4.84E-13 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 2.46E-13 | 8.96E-119 | mr1134_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 1.03E-09 | 3.72E-19 | mr1134_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.51E-41 | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 3.12E-51 | mr1154_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 9.24E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 3.61E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 2.81E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 1.81E-33 | mr1256_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 1.34E-13 | 7.99E-111 | mr1504_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 4.38E-11 | 5.97E-21 | mr1504_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 4.49E-29 | 1.86E-186 | mr1517_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 2.15E-14 | 2.20E-18 | mr1517_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 9.99E-27 | 4.12E-142 | mr1538_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 2.82E-17 | 8.63E-25 | mr1538_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 5.45E-07 | 7.38E-44 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 1.42E-06 | 1.42E-06 | mr1541_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 3.67E-10 | 8.33E-59 | mr1670_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | 3.07E-13 | 2.95E-145 | mr1672_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137855094 | NA | 3.34E-09 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |