Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137837925:

Variant ID: vg0137837925 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37837925
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCGCTAAAAAAACACGTATATAAAAATTTTATTCACAGATTATTTTTCGTTTGCAAATATGTCGTTTGGTTTTTTCCCTGAATAAGCCAACCAAGTA[T/C]
GTAAGTATGTATAATCTTAGGACGTGTTCACTTTGATGCCATTTTAACCTTACCAAATTTTAGTAAAGTTAAAAAAAAAATAGCTACATTTAGTTTGTTA

Reverse complement sequence

TAACAAACTAAATGTAGCTATTTTTTTTTTAACTTTACTAAAATTTGGTAAGGTTAAAATGGCATCAAAGTGAACACGTCCTAAGATTATACATACTTAC[A/G]
TACTTGGTTGGCTTATTCAGGGAAAAAACCAAACGACATATTTGCAAACGAAAAATAATCTGTGAATAAAATTTTTATATACGTGTTTTTTTAGCGATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 46.90% 0.34% 0.00% NA
All Indica  2759 31.40% 68.10% 0.43% 0.00% NA
All Japonica  1512 97.60% 2.30% 0.13% 0.00% NA
Aus  269 0.40% 99.30% 0.37% 0.00% NA
Indica I  595 37.10% 62.50% 0.34% 0.00% NA
Indica II  465 15.30% 84.10% 0.65% 0.00% NA
Indica III  913 39.40% 60.40% 0.22% 0.00% NA
Indica Intermediate  786 27.40% 72.00% 0.64% 0.00% NA
Temperate Japonica  767 97.80% 2.10% 0.13% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137837925 T -> C LOC_Os01g65200.3 downstream_gene_variant ; 999.0bp to feature; MODIFIER silent_mutation Average:37.774; most accessible tissue: Minghui63 flower, score: 82.376 N N N N
vg0137837925 T -> C LOC_Os01g65200.1 downstream_gene_variant ; 999.0bp to feature; MODIFIER silent_mutation Average:37.774; most accessible tissue: Minghui63 flower, score: 82.376 N N N N
vg0137837925 T -> C LOC_Os01g65200.2 downstream_gene_variant ; 999.0bp to feature; MODIFIER silent_mutation Average:37.774; most accessible tissue: Minghui63 flower, score: 82.376 N N N N
vg0137837925 T -> C LOC_Os01g65210.1 intron_variant ; MODIFIER silent_mutation Average:37.774; most accessible tissue: Minghui63 flower, score: 82.376 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0137837925 T C 0.02 0.01 0.01 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137837925 NA 2.19E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 1.40E-09 2.48E-36 mr1375 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 2.40E-06 9.71E-09 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 NA 2.05E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 1.85E-21 2.49E-87 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 2.52E-16 1.00E-19 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 5.80E-18 6.94E-71 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 5.62E-11 1.71E-14 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 1.77E-24 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 8.44E-19 3.87E-20 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 1.35E-20 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137837925 1.69E-13 4.09E-20 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251