\
| Variant ID: vg0137833133 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37833133 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 120. )
GCCAGCGGCGCGCTCGTGTCGGCGATCGACTGAGCGACGAGGAGAGGAGTAGACAGCTGGTTCTCCGACGACATCAACCGCGCCCACCTCGACTACTTCT[A/T]
CTGGATTCTCACTGCACTCGTCGCTTTGGAGGTCGCCGTGTTCGTGTACATTTCAAAGCGATATGTCTACAAGAACAAAGCCGAGGTTTCTGAAAATCTG
CAGATTTTCAGAAACCTCGGCTTTGTTCTTGTAGACATATCGCTTTGAAATGTACACGAACACGGCGACCTCCAAAGCGACGAGTGCAGTGAGAATCCAG[T/A]
AGAAGTAGTCGAGGTGGGCGCGGTTGATGTCGTCGGAGAACCAGCTGTCTACTCCTCTCCTCGTCGCTCAGTCGATCGCCGACACGAGCGCGCCGCTGGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.30% | 17.40% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 70.20% | 29.40% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 63.00% | 36.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 84.90% | 14.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 61.20% | 38.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.50% | 22.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137833133 | A -> T | LOC_Os01g65200.3 | upstream_gene_variant ; 1044.0bp to feature; MODIFIER | silent_mutation | Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 | N | N | N | N |
| vg0137833133 | A -> T | LOC_Os01g65210.1 | upstream_gene_variant ; 4004.0bp to feature; MODIFIER | silent_mutation | Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 | N | N | N | N |
| vg0137833133 | A -> T | LOC_Os01g65200.1 | upstream_gene_variant ; 1044.0bp to feature; MODIFIER | silent_mutation | Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 | N | N | N | N |
| vg0137833133 | A -> T | LOC_Os01g65200.2 | upstream_gene_variant ; 1044.0bp to feature; MODIFIER | silent_mutation | Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 | N | N | N | N |
| vg0137833133 | A -> T | LOC_Os01g65190.1 | downstream_gene_variant ; 752.0bp to feature; MODIFIER | silent_mutation | Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 | N | N | N | N |
| vg0137833133 | A -> T | LOC_Os01g65190-LOC_Os01g65200 | intergenic_region ; MODIFIER | silent_mutation | Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137833133 | NA | 1.52E-07 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137833133 | 2.47E-10 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137833133 | 7.38E-15 | 4.67E-17 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137833133 | 7.38E-09 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137833133 | 2.72E-11 | 1.16E-13 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137833133 | 2.06E-10 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137833133 | 2.51E-17 | 1.83E-17 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137833133 | 5.74E-09 | NA | mr1538_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137833133 | 2.34E-13 | 7.96E-19 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |