\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137833133:

Variant ID: vg0137833133 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37833133
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAGCGGCGCGCTCGTGTCGGCGATCGACTGAGCGACGAGGAGAGGAGTAGACAGCTGGTTCTCCGACGACATCAACCGCGCCCACCTCGACTACTTCT[A/T]
CTGGATTCTCACTGCACTCGTCGCTTTGGAGGTCGCCGTGTTCGTGTACATTTCAAAGCGATATGTCTACAAGAACAAAGCCGAGGTTTCTGAAAATCTG

Reverse complement sequence

CAGATTTTCAGAAACCTCGGCTTTGTTCTTGTAGACATATCGCTTTGAAATGTACACGAACACGGCGACCTCCAAAGCGACGAGTGCAGTGAGAATCCAG[T/A]
AGAAGTAGTCGAGGTGGGCGCGGTTGATGTCGTCGGAGAACCAGCTGTCTACTCCTCTCCTCGTCGCTCAGTCGATCGCCGACACGAGCGCGCCGCTGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 17.40% 0.23% 0.00% NA
All Indica  2759 70.20% 29.40% 0.36% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 63.00% 36.50% 0.50% 0.00% NA
Indica II  465 84.90% 14.60% 0.43% 0.00% NA
Indica III  913 61.20% 38.70% 0.11% 0.00% NA
Indica Intermediate  786 77.50% 22.00% 0.51% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137833133 A -> T LOC_Os01g65200.3 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0137833133 A -> T LOC_Os01g65210.1 upstream_gene_variant ; 4004.0bp to feature; MODIFIER silent_mutation Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0137833133 A -> T LOC_Os01g65200.1 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0137833133 A -> T LOC_Os01g65200.2 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0137833133 A -> T LOC_Os01g65190.1 downstream_gene_variant ; 752.0bp to feature; MODIFIER silent_mutation Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0137833133 A -> T LOC_Os01g65190-LOC_Os01g65200 intergenic_region ; MODIFIER silent_mutation Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137833133 NA 1.52E-07 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133 2.47E-10 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133 7.38E-15 4.67E-17 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133 7.38E-09 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133 2.72E-11 1.16E-13 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133 2.06E-10 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133 2.51E-17 1.83E-17 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133 5.74E-09 NA mr1538_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133 2.34E-13 7.96E-19 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251