Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137833133:

Variant ID: vg0137833133 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37833133
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAGCGGCGCGCTCGTGTCGGCGATCGACTGAGCGACGAGGAGAGGAGTAGACAGCTGGTTCTCCGACGACATCAACCGCGCCCACCTCGACTACTTCT[A/T]
CTGGATTCTCACTGCACTCGTCGCTTTGGAGGTCGCCGTGTTCGTGTACATTTCAAAGCGATATGTCTACAAGAACAAAGCCGAGGTTTCTGAAAATCTG

Reverse complement sequence

CAGATTTTCAGAAACCTCGGCTTTGTTCTTGTAGACATATCGCTTTGAAATGTACACGAACACGGCGACCTCCAAAGCGACGAGTGCAGTGAGAATCCAG[T/A]
AGAAGTAGTCGAGGTGGGCGCGGTTGATGTCGTCGGAGAACCAGCTGTCTACTCCTCTCCTCGTCGCTCAGTCGATCGCCGACACGAGCGCGCCGCTGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.30%	17.40%	0.23%	0.00%	NA
All Indica	2759	70.20%	29.40%	0.36%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	63.00%	36.50%	0.50%	0.00%	NA
Indica II	465	84.90%	14.60%	0.43%	0.00%	NA
Indica III	913	61.20%	38.70%	0.11%	0.00%	NA
Indica Intermediate	786	77.50%	22.00%	0.51%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137833133	A -> T	LOC_Os01g65200.3	upstream_gene_variant ; 1044.0bp to feature; MODIFIER	silent_mutation	Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N
vg0137833133	A -> T	LOC_Os01g65210.1	upstream_gene_variant ; 4004.0bp to feature; MODIFIER	silent_mutation	Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N
vg0137833133	A -> T	LOC_Os01g65200.1	upstream_gene_variant ; 1044.0bp to feature; MODIFIER	silent_mutation	Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N
vg0137833133	A -> T	LOC_Os01g65200.2	upstream_gene_variant ; 1044.0bp to feature; MODIFIER	silent_mutation	Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N
vg0137833133	A -> T	LOC_Os01g65190.1	downstream_gene_variant ; 752.0bp to feature; MODIFIER	silent_mutation	Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N
vg0137833133	A -> T	LOC_Os01g65190-LOC_Os01g65200	intergenic_region ; MODIFIER	silent_mutation	Average:71.055; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137833133	NA	1.52E-07	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133	2.47E-10	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133	7.38E-15	4.67E-17	mr1517	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133	7.38E-09	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133	2.72E-11	1.16E-13	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133	2.06E-10	NA	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133	2.51E-17	1.83E-17	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133	5.74E-09	NA	mr1538_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137833133	2.34E-13	7.96E-19	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251