\
| Variant ID: vg0137832701 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37832701 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )
ATGAATCATTGTGATGCTTAAAATAAATAGAGGACTTATTTATCTTAACTTAGATTGTAGCTCAGAACAACACGAGAATGCAATCGGCGACACAGACGAG[G/T]
CAAACACCAACAGCAACAGCAACAGTAGCGGAATCAACGGACTAACACCCAACACCACATGTGACGGCTGGGAACCAGAACGAAACCCTATTTTTCACTT
AAGTGAAAAATAGGGTTTCGTTCTGGTTCCCAGCCGTCACATGTGGTGTTGGGTGTTAGTCCGTTGATTCCGCTACTGTTGCTGTTGCTGTTGGTGTTTG[C/A]
CTCGTCTGTGTCGCCGATTGCATTCTCGTGTTGTTCTGAGCTACAATCTAAGTTAAGATAAATAAGTCCTCTATTTATTTTAAGCATCACAATGATTCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.40% | 41.30% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 33.70% | 65.80% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 37.60% | 62.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 15.50% | 83.70% | 0.86% | 0.00% | NA |
| Indica III | 913 | 42.30% | 57.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 31.60% | 67.70% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137832701 | G -> T | LOC_Os01g65200.3 | upstream_gene_variant ; 1476.0bp to feature; MODIFIER | silent_mutation | Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0137832701 | G -> T | LOC_Os01g65210.1 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0137832701 | G -> T | LOC_Os01g65200.1 | upstream_gene_variant ; 1476.0bp to feature; MODIFIER | silent_mutation | Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0137832701 | G -> T | LOC_Os01g65200.2 | upstream_gene_variant ; 1476.0bp to feature; MODIFIER | silent_mutation | Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0137832701 | G -> T | LOC_Os01g65190.1 | downstream_gene_variant ; 320.0bp to feature; MODIFIER | silent_mutation | Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0137832701 | G -> T | LOC_Os01g65190-LOC_Os01g65200 | intergenic_region ; MODIFIER | silent_mutation | Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137832701 | NA | 1.86E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 6.47E-11 | 1.85E-28 | mr1375 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 2.29E-08 | 1.29E-10 | mr1375 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 2.16E-18 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 1.02E-14 | 1.78E-18 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 1.32E-16 | 9.63E-73 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 2.91E-10 | 1.43E-13 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 2.12E-24 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 1.34E-18 | 9.06E-21 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 6.92E-20 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832701 | 2.41E-13 | 1.93E-20 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |