\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137832701:

Variant ID: vg0137832701 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37832701
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAATCATTGTGATGCTTAAAATAAATAGAGGACTTATTTATCTTAACTTAGATTGTAGCTCAGAACAACACGAGAATGCAATCGGCGACACAGACGAG[G/T]
CAAACACCAACAGCAACAGCAACAGTAGCGGAATCAACGGACTAACACCCAACACCACATGTGACGGCTGGGAACCAGAACGAAACCCTATTTTTCACTT

Reverse complement sequence

AAGTGAAAAATAGGGTTTCGTTCTGGTTCCCAGCCGTCACATGTGGTGTTGGGTGTTAGTCCGTTGATTCCGCTACTGTTGCTGTTGCTGTTGGTGTTTG[C/A]
CTCGTCTGTGTCGCCGATTGCATTCTCGTGTTGTTCTGAGCTACAATCTAAGTTAAGATAAATAAGTCCTCTATTTATTTTAAGCATCACAATGATTCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.30% 0.30% 0.00% NA
All Indica  2759 33.70% 65.80% 0.51% 0.00% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 37.60% 62.00% 0.34% 0.00% NA
Indica II  465 15.50% 83.70% 0.86% 0.00% NA
Indica III  913 42.30% 57.50% 0.22% 0.00% NA
Indica Intermediate  786 31.60% 67.70% 0.76% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137832701 G -> T LOC_Os01g65200.3 upstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0137832701 G -> T LOC_Os01g65210.1 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0137832701 G -> T LOC_Os01g65200.1 upstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0137832701 G -> T LOC_Os01g65200.2 upstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0137832701 G -> T LOC_Os01g65190.1 downstream_gene_variant ; 320.0bp to feature; MODIFIER silent_mutation Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0137832701 G -> T LOC_Os01g65190-LOC_Os01g65200 intergenic_region ; MODIFIER silent_mutation Average:57.137; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137832701 NA 1.86E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 6.47E-11 1.85E-28 mr1375 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 2.29E-08 1.29E-10 mr1375 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 2.16E-18 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 1.02E-14 1.78E-18 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 1.32E-16 9.63E-73 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 2.91E-10 1.43E-13 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 2.12E-24 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 1.34E-18 9.06E-21 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 6.92E-20 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832701 2.41E-13 1.93E-20 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251