\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137817100:

Variant ID: vg0137817100 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37817100
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGAGTACAAGTACTTGGTGGCTGGGGCATGCTTGGATTGTATCCATCAGACGAAAAAGGCTGAAATTCCTGTTGTTTGGTGTAAGTGCATATAAAAA[G/A]
TTAGAGTCAGATATTAGCTCTACGTTATTTAGAGATTAGCATTCTACAACAATTAGAGACAATATGGTTTCTAATAATTAATGTATAAAAATATTTTTTC

Reverse complement sequence

GAAAAAATATTTTTATACATTAATTATTAGAAACCATATTGTCTCTAATTGTTGTAGAATGCTAATCTCTAAATAACGTAGAGCTAATATCTGACTCTAA[C/T]
TTTTTATATGCACTTACACCAAACAACAGGAATTTCAGCCTTTTTCGTCTGATGGATACAATCCAAGCATGCCCCAGCCACCAAGTACTTGTACTCCATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 41.20% 0.04% 0.00% NA
All Indica  2759 96.20% 3.80% 0.00% 0.00% NA
All Japonica  1512 1.90% 98.00% 0.07% 0.00% NA
Aus  269 24.20% 75.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 91.20% 8.80% 0.00% 0.00% NA
Temperate Japonica  767 1.70% 98.20% 0.13% 0.00% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137817100 G -> A LOC_Os01g65169.1 upstream_gene_variant ; 4118.0bp to feature; MODIFIER silent_mutation Average:43.421; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0137817100 G -> A LOC_Os01g65140.1 downstream_gene_variant ; 4971.0bp to feature; MODIFIER silent_mutation Average:43.421; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0137817100 G -> A LOC_Os01g65150.1 downstream_gene_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:43.421; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0137817100 G -> A LOC_Os01g65150-LOC_Os01g65169 intergenic_region ; MODIFIER silent_mutation Average:43.421; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137817100 NA 3.25E-50 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 6.36E-08 1.59E-88 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 1.81E-06 1.15E-77 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 6.64E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 5.73E-16 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 2.26E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 9.13E-34 mr1737 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 8.42E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 2.63E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 3.42E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 1.45E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 1.27E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 8.24E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 2.06E-21 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 3.66E-10 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 4.21E-07 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 3.43E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 1.92E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 5.30E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100 NA 5.82E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251