Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137817100:

Variant ID: vg0137817100 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37817100
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGGAGTACAAGTACTTGGTGGCTGGGGCATGCTTGGATTGTATCCATCAGACGAAAAAGGCTGAAATTCCTGTTGTTTGGTGTAAGTGCATATAAAAA[G/A]
TTAGAGTCAGATATTAGCTCTACGTTATTTAGAGATTAGCATTCTACAACAATTAGAGACAATATGGTTTCTAATAATTAATGTATAAAAATATTTTTTC

Reverse complement sequence

GAAAAAATATTTTTATACATTAATTATTAGAAACCATATTGTCTCTAATTGTTGTAGAATGCTAATCTCTAAATAACGTAGAGCTAATATCTGACTCTAA[C/T]
TTTTTATATGCACTTACACCAAACAACAGGAATTTCAGCCTTTTTCGTCTGATGGATACAATCCAAGCATGCCCCAGCCACCAAGTACTTGTACTCCATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	41.20%	0.04%	0.00%	NA
All Indica	2759	96.20%	3.80%	0.00%	0.00%	NA
All Japonica	1512	1.90%	98.00%	0.07%	0.00%	NA
Aus	269	24.20%	75.80%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	96.50%	3.50%	0.00%	0.00%	NA
Indica Intermediate	786	91.20%	8.80%	0.00%	0.00%	NA
Temperate Japonica	767	1.70%	98.20%	0.13%	0.00%	NA
Tropical Japonica	504	2.20%	97.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	33.30%	65.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137817100	G -> A	LOC_Os01g65169.1	upstream_gene_variant ; 4118.0bp to feature; MODIFIER	silent_mutation	Average:43.421; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0137817100	G -> A	LOC_Os01g65140.1	downstream_gene_variant ; 4971.0bp to feature; MODIFIER	silent_mutation	Average:43.421; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0137817100	G -> A	LOC_Os01g65150.1	downstream_gene_variant ; 325.0bp to feature; MODIFIER	silent_mutation	Average:43.421; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0137817100	G -> A	LOC_Os01g65150-LOC_Os01g65169	intergenic_region ; MODIFIER	silent_mutation	Average:43.421; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137817100	NA	3.25E-50	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	6.36E-08	1.59E-88	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	1.81E-06	1.15E-77	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	6.64E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	5.73E-16	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	2.26E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	9.13E-34	mr1737	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	8.42E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	2.63E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	3.42E-63	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	1.45E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	1.27E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	8.24E-26	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	2.06E-21	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	3.66E-10	NA	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	4.21E-07	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	3.43E-32	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	1.92E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	5.30E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137817100	NA	5.82E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251