\
| Variant ID: vg0137799856 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37799856 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 113. )
ACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATTTCTATATGTACTCTATACTCTACTTCTAATATT[T/C]
CTTATTTTTAATTCCGAATTTCATTTATTTCCTAATTGTATTTCTATATGGACTCTAGAGGAGAGACTCTAGTCTCCTCTTTTAATATTACTTATTTTTT
AAAAAATAAGTAATATTAAAAGAGGAGACTAGAGTCTCTCCTCTAGAGTCCATATAGAAATACAATTAGGAAATAAATGAAATTCGGAATTAAAAATAAG[A/G]
AATATTAGAAGTAGAGTATAGAGTACATATAGAAATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.90% | 17.00% | 3.32% | 37.71% | NA |
| All Indica | 2759 | 5.00% | 28.80% | 5.62% | 60.57% | NA |
| All Japonica | 1512 | 98.10% | 0.10% | 0.00% | 1.79% | NA |
| Aus | 269 | 76.20% | 0.00% | 0.74% | 23.05% | NA |
| Indica I | 595 | 0.80% | 36.30% | 4.03% | 58.82% | NA |
| Indica II | 465 | 1.90% | 14.40% | 0.86% | 82.80% | NA |
| Indica III | 913 | 4.90% | 37.70% | 9.97% | 47.43% | NA |
| Indica Intermediate | 786 | 10.10% | 21.40% | 4.58% | 63.99% | NA |
| Temperate Japonica | 767 | 98.30% | 0.10% | 0.00% | 1.56% | NA |
| Tropical Japonica | 504 | 97.80% | 0.20% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 68.90% | 8.90% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137799856 | T -> DEL | N | N | silent_mutation | Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0137799856 | T -> C | LOC_Os01g65120.1 | upstream_gene_variant ; 1100.0bp to feature; MODIFIER | silent_mutation | Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0137799856 | T -> C | LOC_Os01g65130.1 | upstream_gene_variant ; 4162.0bp to feature; MODIFIER | silent_mutation | Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0137799856 | T -> C | LOC_Os01g65110.1 | downstream_gene_variant ; 2110.0bp to feature; MODIFIER | silent_mutation | Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0137799856 | T -> C | LOC_Os01g65110-LOC_Os01g65120 | intergenic_region ; MODIFIER | silent_mutation | Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137799856 | NA | 3.57E-06 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799856 | 1.10E-09 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799856 | 5.14E-14 | 1.64E-16 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799856 | 6.47E-07 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799856 | 6.49E-09 | 4.96E-12 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799856 | 1.50E-10 | NA | mr1517_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799856 | 5.81E-18 | 1.19E-16 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799856 | 8.93E-08 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799856 | 6.83E-12 | 3.70E-17 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |