\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137799856:

Variant ID: vg0137799856 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37799856
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATTTCTATATGTACTCTATACTCTACTTCTAATATT[T/C]
CTTATTTTTAATTCCGAATTTCATTTATTTCCTAATTGTATTTCTATATGGACTCTAGAGGAGAGACTCTAGTCTCCTCTTTTAATATTACTTATTTTTT

Reverse complement sequence

AAAAAATAAGTAATATTAAAAGAGGAGACTAGAGTCTCTCCTCTAGAGTCCATATAGAAATACAATTAGGAAATAAATGAAATTCGGAATTAAAAATAAG[A/G]
AATATTAGAAGTAGAGTATAGAGTACATATAGAAATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.90% 17.00% 3.32% 37.71% NA
All Indica  2759 5.00% 28.80% 5.62% 60.57% NA
All Japonica  1512 98.10% 0.10% 0.00% 1.79% NA
Aus  269 76.20% 0.00% 0.74% 23.05% NA
Indica I  595 0.80% 36.30% 4.03% 58.82% NA
Indica II  465 1.90% 14.40% 0.86% 82.80% NA
Indica III  913 4.90% 37.70% 9.97% 47.43% NA
Indica Intermediate  786 10.10% 21.40% 4.58% 63.99% NA
Temperate Japonica  767 98.30% 0.10% 0.00% 1.56% NA
Tropical Japonica  504 97.80% 0.20% 0.00% 1.98% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 68.90% 8.90% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137799856 T -> DEL N N silent_mutation Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0137799856 T -> C LOC_Os01g65120.1 upstream_gene_variant ; 1100.0bp to feature; MODIFIER silent_mutation Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0137799856 T -> C LOC_Os01g65130.1 upstream_gene_variant ; 4162.0bp to feature; MODIFIER silent_mutation Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0137799856 T -> C LOC_Os01g65110.1 downstream_gene_variant ; 2110.0bp to feature; MODIFIER silent_mutation Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0137799856 T -> C LOC_Os01g65110-LOC_Os01g65120 intergenic_region ; MODIFIER silent_mutation Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137799856 NA 3.57E-06 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856 1.10E-09 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856 5.14E-14 1.64E-16 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856 6.47E-07 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856 6.49E-09 4.96E-12 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856 1.50E-10 NA mr1517_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856 5.81E-18 1.19E-16 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856 8.93E-08 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856 6.83E-12 3.70E-17 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251