\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137799491:

Variant ID: vg0137799491 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37799491
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTACTTTTAATTTTATTATGTTTATTCCAAATTTTAGTTAGTTTTAAATTCCTATATGAACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTC[T/C]
GAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCTATACACTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCTATTATTTCCTAATTGT

Reverse complement sequence

ACAATTAGGAAATAATAGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGTGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTC[A/G]
GAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTTCATATAGGAATTTAAAACTAACTAAAATTTGGAATAAACATAATAAAATTAAAAGTAGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.40% 0.40% 20.80% 41.39% NA
All Indica  2759 3.80% 0.40% 29.03% 66.76% NA
All Japonica  1512 97.90% 0.00% 0.26% 1.85% NA
Aus  269 10.80% 3.70% 63.20% 22.30% NA
Indica I  595 1.30% 0.50% 29.41% 68.74% NA
Indica II  465 2.40% 0.40% 12.90% 84.30% NA
Indica III  913 3.30% 0.50% 41.51% 54.65% NA
Indica Intermediate  786 7.10% 0.10% 23.79% 68.96% NA
Temperate Japonica  767 98.30% 0.00% 0.00% 1.69% NA
Tropical Japonica  504 97.60% 0.00% 0.40% 1.98% NA
Japonica Intermediate  241 97.10% 0.00% 0.83% 2.07% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 64.40% 0.00% 8.89% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137799491 T -> DEL N N silent_mutation Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0137799491 T -> C LOC_Os01g65120.1 upstream_gene_variant ; 1465.0bp to feature; MODIFIER silent_mutation Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0137799491 T -> C LOC_Os01g65130.1 upstream_gene_variant ; 4527.0bp to feature; MODIFIER silent_mutation Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0137799491 T -> C LOC_Os01g65110.1 downstream_gene_variant ; 1745.0bp to feature; MODIFIER silent_mutation Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0137799491 T -> C LOC_Os01g65110-LOC_Os01g65120 intergenic_region ; MODIFIER silent_mutation Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137799491 4.15E-06 NA mr1003 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491 NA 6.64E-07 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491 1.00E-07 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491 7.93E-13 7.61E-15 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491 2.84E-07 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491 3.77E-10 1.51E-12 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491 1.68E-07 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491 1.52E-13 4.09E-15 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491 4.61E-09 3.89E-15 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251