\
| Variant ID: vg0137799491 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37799491 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 109. )
CTCTACTTTTAATTTTATTATGTTTATTCCAAATTTTAGTTAGTTTTAAATTCCTATATGAACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTC[T/C]
GAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCTATACACTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCTATTATTTCCTAATTGT
ACAATTAGGAAATAATAGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGTGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTC[A/G]
GAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTTCATATAGGAATTTAAAACTAACTAAAATTTGGAATAAACATAATAAAATTAAAAGTAGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.40% | 0.40% | 20.80% | 41.39% | NA |
| All Indica | 2759 | 3.80% | 0.40% | 29.03% | 66.76% | NA |
| All Japonica | 1512 | 97.90% | 0.00% | 0.26% | 1.85% | NA |
| Aus | 269 | 10.80% | 3.70% | 63.20% | 22.30% | NA |
| Indica I | 595 | 1.30% | 0.50% | 29.41% | 68.74% | NA |
| Indica II | 465 | 2.40% | 0.40% | 12.90% | 84.30% | NA |
| Indica III | 913 | 3.30% | 0.50% | 41.51% | 54.65% | NA |
| Indica Intermediate | 786 | 7.10% | 0.10% | 23.79% | 68.96% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.40% | 1.98% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 64.40% | 0.00% | 8.89% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137799491 | T -> DEL | N | N | silent_mutation | Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0137799491 | T -> C | LOC_Os01g65120.1 | upstream_gene_variant ; 1465.0bp to feature; MODIFIER | silent_mutation | Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0137799491 | T -> C | LOC_Os01g65130.1 | upstream_gene_variant ; 4527.0bp to feature; MODIFIER | silent_mutation | Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0137799491 | T -> C | LOC_Os01g65110.1 | downstream_gene_variant ; 1745.0bp to feature; MODIFIER | silent_mutation | Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0137799491 | T -> C | LOC_Os01g65110-LOC_Os01g65120 | intergenic_region ; MODIFIER | silent_mutation | Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137799491 | 4.15E-06 | NA | mr1003 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799491 | NA | 6.64E-07 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799491 | 1.00E-07 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799491 | 7.93E-13 | 7.61E-15 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799491 | 2.84E-07 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799491 | 3.77E-10 | 1.51E-12 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799491 | 1.68E-07 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799491 | 1.52E-13 | 4.09E-15 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137799491 | 4.61E-09 | 3.89E-15 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |