Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137799491:

Variant ID: vg0137799491 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37799491
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CTCTACTTTTAATTTTATTATGTTTATTCCAAATTTTAGTTAGTTTTAAATTCCTATATGAACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTC[T/C]
GAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCTATACACTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCTATTATTTCCTAATTGT

Reverse complement sequence

ACAATTAGGAAATAATAGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGTGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTC[A/G]
GAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTTCATATAGGAATTTAAAACTAACTAAAATTTGGAATAAACATAATAAAATTAAAAGTAGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.40%	0.40%	20.80%	41.39%	NA
All Indica	2759	3.80%	0.40%	29.03%	66.76%	NA
All Japonica	1512	97.90%	0.00%	0.26%	1.85%	NA
Aus	269	10.80%	3.70%	63.20%	22.30%	NA
Indica I	595	1.30%	0.50%	29.41%	68.74%	NA
Indica II	465	2.40%	0.40%	12.90%	84.30%	NA
Indica III	913	3.30%	0.50%	41.51%	54.65%	NA
Indica Intermediate	786	7.10%	0.10%	23.79%	68.96%	NA
Temperate Japonica	767	98.30%	0.00%	0.00%	1.69%	NA
Tropical Japonica	504	97.60%	0.00%	0.40%	1.98%	NA
Japonica Intermediate	241	97.10%	0.00%	0.83%	2.07%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	64.40%	0.00%	8.89%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137799491	T -> DEL	N	N	silent_mutation	Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0137799491	T -> C	LOC_Os01g65120.1	upstream_gene_variant ; 1465.0bp to feature; MODIFIER	silent_mutation	Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0137799491	T -> C	LOC_Os01g65130.1	upstream_gene_variant ; 4527.0bp to feature; MODIFIER	silent_mutation	Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0137799491	T -> C	LOC_Os01g65110.1	downstream_gene_variant ; 1745.0bp to feature; MODIFIER	silent_mutation	Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0137799491	T -> C	LOC_Os01g65110-LOC_Os01g65120	intergenic_region ; MODIFIER	silent_mutation	Average:12.037; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137799491	4.15E-06	NA	mr1003	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491	NA	6.64E-07	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491	1.00E-07	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491	7.93E-13	7.61E-15	mr1517	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491	2.84E-07	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491	3.77E-10	1.51E-12	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491	1.68E-07	NA	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491	1.52E-13	4.09E-15	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799491	4.61E-09	3.89E-15	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251