\
| Variant ID: vg0137798144 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37798144 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )
AAATCTTAGCTTCGAACAAGCCTTGTTTTTAGTTTTTAGACTATGGGCTGCCTAAGTGTGTAGGTGGTTAACCTGTGAATTTACTTATAAGTCAAAATAG[G/A]
TTGCGGACCTATTTATTTTAACATGTAAGTTAGTATGCGAATTATCTGTTTACACCTGACTGTCTATACAATTTTTAACAGAAAATCCCATTCCACATAA
TTATGTGGAATGGGATTTTCTGTTAAAAATTGTATAGACAGTCAGGTGTAAACAGATAATTCGCATACTAACTTACATGTTAAAATAAATAGGTCCGCAA[C/T]
CTATTTTGACTTATAAGTAAATTCACAGGTTAACCACCTACACACTTAGGCAGCCCATAGTCTAAAAACTAAAAACAAGGCTTGTTCGAAGCTAAGATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 41.10% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 33.50% | 66.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 37.60% | 62.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 15.50% | 84.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 42.20% | 57.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 31.00% | 68.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137798144 | G -> A | LOC_Os01g65120.1 | upstream_gene_variant ; 2812.0bp to feature; MODIFIER | silent_mutation | Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623 | N | N | N | N |
| vg0137798144 | G -> A | LOC_Os01g65110.1 | downstream_gene_variant ; 398.0bp to feature; MODIFIER | silent_mutation | Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623 | N | N | N | N |
| vg0137798144 | G -> A | LOC_Os01g65110-LOC_Os01g65120 | intergenic_region ; MODIFIER | silent_mutation | Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137798144 | NA | 4.37E-13 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 8.45E-07 | NA | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 1.10E-06 | 5.31E-09 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 2.27E-18 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 5.55E-18 | 2.59E-21 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 1.78E-15 | 1.67E-70 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 1.20E-12 | 2.13E-15 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 3.21E-19 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 7.97E-21 | 1.86E-22 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 1.36E-16 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137798144 | 2.16E-15 | 5.37E-22 | mr1538_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |