\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137798144:

Variant ID: vg0137798144 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37798144
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCTTAGCTTCGAACAAGCCTTGTTTTTAGTTTTTAGACTATGGGCTGCCTAAGTGTGTAGGTGGTTAACCTGTGAATTTACTTATAAGTCAAAATAG[G/A]
TTGCGGACCTATTTATTTTAACATGTAAGTTAGTATGCGAATTATCTGTTTACACCTGACTGTCTATACAATTTTTAACAGAAAATCCCATTCCACATAA

Reverse complement sequence

TTATGTGGAATGGGATTTTCTGTTAAAAATTGTATAGACAGTCAGGTGTAAACAGATAATTCGCATACTAACTTACATGTTAAAATAAATAGGTCCGCAA[C/T]
CTATTTTGACTTATAAGTAAATTCACAGGTTAACCACCTACACACTTAGGCAGCCCATAGTCTAAAAACTAAAAACAAGGCTTGTTCGAAGCTAAGATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 41.10% 0.13% 0.00% NA
All Indica  2759 33.50% 66.30% 0.14% 0.00% NA
All Japonica  1512 98.10% 1.80% 0.07% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 37.60% 62.40% 0.00% 0.00% NA
Indica II  465 15.50% 84.30% 0.22% 0.00% NA
Indica III  913 42.20% 57.70% 0.11% 0.00% NA
Indica Intermediate  786 31.00% 68.70% 0.25% 0.00% NA
Temperate Japonica  767 98.30% 1.60% 0.13% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137798144 G -> A LOC_Os01g65120.1 upstream_gene_variant ; 2812.0bp to feature; MODIFIER silent_mutation Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N
vg0137798144 G -> A LOC_Os01g65110.1 downstream_gene_variant ; 398.0bp to feature; MODIFIER silent_mutation Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N
vg0137798144 G -> A LOC_Os01g65110-LOC_Os01g65120 intergenic_region ; MODIFIER silent_mutation Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137798144 NA 4.37E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 8.45E-07 NA mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 1.10E-06 5.31E-09 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 2.27E-18 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 5.55E-18 2.59E-21 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 1.78E-15 1.67E-70 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 1.20E-12 2.13E-15 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 3.21E-19 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 7.97E-21 1.86E-22 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 1.36E-16 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144 2.16E-15 5.37E-22 mr1538_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251