RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0137798144:

Variant ID: vg0137798144 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37798144
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

AAATCTTAGCTTCGAACAAGCCTTGTTTTTAGTTTTTAGACTATGGGCTGCCTAAGTGTGTAGGTGGTTAACCTGTGAATTTACTTATAAGTCAAAATAG[G/A]
TTGCGGACCTATTTATTTTAACATGTAAGTTAGTATGCGAATTATCTGTTTACACCTGACTGTCTATACAATTTTTAACAGAAAATCCCATTCCACATAA

Reverse complement sequence

TTATGTGGAATGGGATTTTCTGTTAAAAATTGTATAGACAGTCAGGTGTAAACAGATAATTCGCATACTAACTTACATGTTAAAATAAATAGGTCCGCAA[C/T]
CTATTTTGACTTATAAGTAAATTCACAGGTTAACCACCTACACACTTAGGCAGCCCATAGTCTAAAAACTAAAAACAAGGCTTGTTCGAAGCTAAGATTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	41.10%	0.13%	0.00%	NA
All Indica	2759	33.50%	66.30%	0.14%	0.00%	NA
All Japonica	1512	98.10%	1.80%	0.07%	0.00%	NA
Aus	269	76.20%	23.80%	0.00%	0.00%	NA
Indica I	595	37.60%	62.40%	0.00%	0.00%	NA
Indica II	465	15.50%	84.30%	0.22%	0.00%	NA
Indica III	913	42.20%	57.70%	0.11%	0.00%	NA
Indica Intermediate	786	31.00%	68.70%	0.25%	0.00%	NA
Temperate Japonica	767	98.30%	1.60%	0.13%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137798144	G -> A	LOC_Os01g65120.1	upstream_gene_variant ; 2812.0bp to feature; MODIFIER	silent_mutation	Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623	N	N	N	N
vg0137798144	G -> A	LOC_Os01g65110.1	downstream_gene_variant ; 398.0bp to feature; MODIFIER	silent_mutation	Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623	N	N	N	N
vg0137798144	G -> A	LOC_Os01g65110-LOC_Os01g65120	intergenic_region ; MODIFIER	silent_mutation	Average:45.877; most accessible tissue: Zhenshan97 flower, score: 67.623	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137798144	NA	4.37E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	8.45E-07	NA	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	1.10E-06	5.31E-09	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	2.27E-18	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	5.55E-18	2.59E-21	mr1517	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	1.78E-15	1.67E-70	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	1.20E-12	2.13E-15	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	3.21E-19	NA	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	7.97E-21	1.86E-22	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137798144	1.36E-16	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 11 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0137798144:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact