\
| Variant ID: vg0137613833 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37613833 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACCCTAACTGGATTCAACGACGCTACTCCCTTGAGCAGCTTCACCGTGCACTGTCTACCAACGACGCCGTAATGAAATGTTTTAGTACTTCTACTTGGCA[A/T]
CGCAACAGAACACAAATGTATACTCCCTCCGTACGTGTAAAGAAATCATTTAGGACAATATTTAAGTCAAATCTTGAGAATATAAATCATGAATACTCCC
GGGAGTATTCATGATTTATATTCTCAAGATTTGACTTAAATATTGTCCTAAATGATTTCTTTACACGTACGGAGGGAGTATACATTTGTGTTCTGTTGCG[T/A]
TGCCAAGTAGAAGTACTAAAACATTTCATTACGGCGTCGTTGGTAGACAGTGCACGGTGAAGCTGCTCAAGGGAGTAGCGTCGTTGAATCCAGTTAGGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.10% | 10.00% | 13.03% | 41.87% | NA |
| All Indica | 2759 | 17.10% | 0.10% | 14.43% | 68.39% | NA |
| All Japonica | 1512 | 64.40% | 29.80% | 4.37% | 1.46% | NA |
| Aus | 269 | 31.20% | 0.00% | 51.30% | 17.47% | NA |
| Indica I | 595 | 6.70% | 0.00% | 8.24% | 85.04% | NA |
| Indica II | 465 | 12.00% | 0.20% | 13.33% | 74.41% | NA |
| Indica III | 913 | 23.20% | 0.00% | 13.36% | 63.42% | NA |
| Indica Intermediate | 786 | 20.70% | 0.30% | 20.99% | 58.02% | NA |
| Temperate Japonica | 767 | 45.20% | 47.10% | 6.13% | 1.56% | NA |
| Tropical Japonica | 504 | 85.10% | 11.30% | 2.18% | 1.39% | NA |
| Japonica Intermediate | 241 | 81.70% | 13.70% | 3.32% | 1.24% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 42.20% | 20.00% | 13.33% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137613833 | A -> T | LOC_Os01g64810.1 | downstream_gene_variant ; 2122.0bp to feature; MODIFIER | silent_mutation | Average:63.064; most accessible tissue: Minghui63 root, score: 87.519 | N | N | N | N |
| vg0137613833 | A -> T | LOC_Os01g64810.2 | downstream_gene_variant ; 2871.0bp to feature; MODIFIER | silent_mutation | Average:63.064; most accessible tissue: Minghui63 root, score: 87.519 | N | N | N | N |
| vg0137613833 | A -> T | LOC_Os01g64800-LOC_Os01g64810 | intergenic_region ; MODIFIER | silent_mutation | Average:63.064; most accessible tissue: Minghui63 root, score: 87.519 | N | N | N | N |
| vg0137613833 | A -> DEL | N | N | silent_mutation | Average:63.064; most accessible tissue: Minghui63 root, score: 87.519 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137613833 | 5.97E-07 | 1.29E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137613833 | NA | 1.94E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137613833 | 5.75E-07 | 1.04E-25 | mr1010_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137613833 | NA | 6.52E-12 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137613833 | 2.41E-06 | NA | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137613833 | NA | 9.65E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137613833 | NA | 1.03E-06 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137613833 | NA | 3.65E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137613833 | NA | 2.75E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |