\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137613833:

Variant ID: vg0137613833 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37613833
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCCTAACTGGATTCAACGACGCTACTCCCTTGAGCAGCTTCACCGTGCACTGTCTACCAACGACGCCGTAATGAAATGTTTTAGTACTTCTACTTGGCA[A/T]
CGCAACAGAACACAAATGTATACTCCCTCCGTACGTGTAAAGAAATCATTTAGGACAATATTTAAGTCAAATCTTGAGAATATAAATCATGAATACTCCC

Reverse complement sequence

GGGAGTATTCATGATTTATATTCTCAAGATTTGACTTAAATATTGTCCTAAATGATTTCTTTACACGTACGGAGGGAGTATACATTTGTGTTCTGTTGCG[T/A]
TGCCAAGTAGAAGTACTAAAACATTTCATTACGGCGTCGTTGGTAGACAGTGCACGGTGAAGCTGCTCAAGGGAGTAGCGTCGTTGAATCCAGTTAGGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.10% 10.00% 13.03% 41.87% NA
All Indica  2759 17.10% 0.10% 14.43% 68.39% NA
All Japonica  1512 64.40% 29.80% 4.37% 1.46% NA
Aus  269 31.20% 0.00% 51.30% 17.47% NA
Indica I  595 6.70% 0.00% 8.24% 85.04% NA
Indica II  465 12.00% 0.20% 13.33% 74.41% NA
Indica III  913 23.20% 0.00% 13.36% 63.42% NA
Indica Intermediate  786 20.70% 0.30% 20.99% 58.02% NA
Temperate Japonica  767 45.20% 47.10% 6.13% 1.56% NA
Tropical Japonica  504 85.10% 11.30% 2.18% 1.39% NA
Japonica Intermediate  241 81.70% 13.70% 3.32% 1.24% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 42.20% 20.00% 13.33% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137613833 A -> T LOC_Os01g64810.1 downstream_gene_variant ; 2122.0bp to feature; MODIFIER silent_mutation Average:63.064; most accessible tissue: Minghui63 root, score: 87.519 N N N N
vg0137613833 A -> T LOC_Os01g64810.2 downstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:63.064; most accessible tissue: Minghui63 root, score: 87.519 N N N N
vg0137613833 A -> T LOC_Os01g64800-LOC_Os01g64810 intergenic_region ; MODIFIER silent_mutation Average:63.064; most accessible tissue: Minghui63 root, score: 87.519 N N N N
vg0137613833 A -> DEL N N silent_mutation Average:63.064; most accessible tissue: Minghui63 root, score: 87.519 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137613833 5.97E-07 1.29E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137613833 NA 1.94E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137613833 5.75E-07 1.04E-25 mr1010_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137613833 NA 6.52E-12 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137613833 2.41E-06 NA mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137613833 NA 9.65E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137613833 NA 1.03E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137613833 NA 3.65E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137613833 NA 2.75E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251