\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137414650:

Variant ID: vg0137414650 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37414650
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAACCTAATTAATCCACAATTAGAGAATGTTTACTGTAACATCACATAGGCTAATTATGGATTAATTAGGCTCAATAAATTCGTCTCGCGAATTAGTC[C/T]
AAGATTATGGATGGATTTTATTAATAGTCTATGTTTAATATTTATAATTAGTGTCCAAACATCCAATGTGATATGGACTTAGAAGTTTTAGTCCCATCTA

Reverse complement sequence

TAGATGGGACTAAAACTTCTAAGTCCATATCACATTGGATGTTTGGACACTAATTATAAATATTAAACATAGACTATTAATAAAATCCATCCATAATCTT[G/A]
GACTAATTCGCGAGACGAATTTATTGAGCCTAATTAATCCATAATTAGCCTATGTGATGTTACAGTAAACATTCTCTAATTGTGGATTAATTAGGTTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 17.30% 4.51% 0.00% NA
All Indica  2759 64.20% 28.30% 7.54% 0.00% NA
All Japonica  1512 98.30% 1.60% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 45.90% 33.60% 20.50% 0.00% NA
Indica II  465 20.20% 72.00% 7.74% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 63.60% 30.00% 6.36% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137414650 C -> T LOC_Os01g64470.1 upstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0137414650 C -> T LOC_Os01g64460.1 downstream_gene_variant ; 3276.0bp to feature; MODIFIER silent_mutation Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0137414650 C -> T LOC_Os01g64480.1 downstream_gene_variant ; 1165.0bp to feature; MODIFIER silent_mutation Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0137414650 C -> T LOC_Os01g64490.1 downstream_gene_variant ; 2380.0bp to feature; MODIFIER silent_mutation Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0137414650 C -> T LOC_Os01g64470-LOC_Os01g64480 intergenic_region ; MODIFIER silent_mutation Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137414650 NA 6.98E-09 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 6.50E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 2.27E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 6.54E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 3.29E-07 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 2.86E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 4.98E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 1.45E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 1.19E-15 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 9.41E-07 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 4.05E-07 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 1.54E-06 5.66E-06 mr1538_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 5.51E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 1.28E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 7.40E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 1.37E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 3.19E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 4.73E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650 NA 1.58E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251