Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137414650:

Variant ID: vg0137414650 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37414650
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAAACCTAATTAATCCACAATTAGAGAATGTTTACTGTAACATCACATAGGCTAATTATGGATTAATTAGGCTCAATAAATTCGTCTCGCGAATTAGTC[C/T]
AAGATTATGGATGGATTTTATTAATAGTCTATGTTTAATATTTATAATTAGTGTCCAAACATCCAATGTGATATGGACTTAGAAGTTTTAGTCCCATCTA

Reverse complement sequence

TAGATGGGACTAAAACTTCTAAGTCCATATCACATTGGATGTTTGGACACTAATTATAAATATTAAACATAGACTATTAATAAAATCCATCCATAATCTT[G/A]
GACTAATTCGCGAGACGAATTTATTGAGCCTAATTAATCCATAATTAGCCTATGTGATGTTACAGTAAACATTCTCTAATTGTGGATTAATTAGGTTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	17.30%	4.51%	0.00%	NA
All Indica	2759	64.20%	28.30%	7.54%	0.00%	NA
All Japonica	1512	98.30%	1.60%	0.13%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	45.90%	33.60%	20.50%	0.00%	NA
Indica II	465	20.20%	72.00%	7.74%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	63.60%	30.00%	6.36%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.00%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137414650	C -> T	LOC_Os01g64470.1	upstream_gene_variant ; 1639.0bp to feature; MODIFIER	silent_mutation	Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N
vg0137414650	C -> T	LOC_Os01g64460.1	downstream_gene_variant ; 3276.0bp to feature; MODIFIER	silent_mutation	Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N
vg0137414650	C -> T	LOC_Os01g64480.1	downstream_gene_variant ; 1165.0bp to feature; MODIFIER	silent_mutation	Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N
vg0137414650	C -> T	LOC_Os01g64490.1	downstream_gene_variant ; 2380.0bp to feature; MODIFIER	silent_mutation	Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N
vg0137414650	C -> T	LOC_Os01g64470-LOC_Os01g64480	intergenic_region ; MODIFIER	silent_mutation	Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137414650	NA	6.98E-09	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	6.50E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	2.27E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	6.54E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	3.29E-07	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	2.86E-10	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	4.98E-09	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	1.45E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	1.19E-15	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	9.41E-07	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	4.05E-07	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	1.54E-06	5.66E-06	mr1538_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	5.51E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	1.28E-09	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	7.40E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	1.37E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	3.19E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	4.73E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137414650	NA	1.58E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251