| Variant ID: vg0137414650 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37414650 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAAACCTAATTAATCCACAATTAGAGAATGTTTACTGTAACATCACATAGGCTAATTATGGATTAATTAGGCTCAATAAATTCGTCTCGCGAATTAGTC[C/T]
AAGATTATGGATGGATTTTATTAATAGTCTATGTTTAATATTTATAATTAGTGTCCAAACATCCAATGTGATATGGACTTAGAAGTTTTAGTCCCATCTA
TAGATGGGACTAAAACTTCTAAGTCCATATCACATTGGATGTTTGGACACTAATTATAAATATTAAACATAGACTATTAATAAAATCCATCCATAATCTT[G/A]
GACTAATTCGCGAGACGAATTTATTGAGCCTAATTAATCCATAATTAGCCTATGTGATGTTACAGTAAACATTCTCTAATTGTGGATTAATTAGGTTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 17.30% | 4.51% | 0.00% | NA |
| All Indica | 2759 | 64.20% | 28.30% | 7.54% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.60% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 45.90% | 33.60% | 20.50% | 0.00% | NA |
| Indica II | 465 | 20.20% | 72.00% | 7.74% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 63.60% | 30.00% | 6.36% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137414650 | C -> T | LOC_Os01g64470.1 | upstream_gene_variant ; 1639.0bp to feature; MODIFIER | silent_mutation | Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0137414650 | C -> T | LOC_Os01g64460.1 | downstream_gene_variant ; 3276.0bp to feature; MODIFIER | silent_mutation | Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0137414650 | C -> T | LOC_Os01g64480.1 | downstream_gene_variant ; 1165.0bp to feature; MODIFIER | silent_mutation | Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0137414650 | C -> T | LOC_Os01g64490.1 | downstream_gene_variant ; 2380.0bp to feature; MODIFIER | silent_mutation | Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0137414650 | C -> T | LOC_Os01g64470-LOC_Os01g64480 | intergenic_region ; MODIFIER | silent_mutation | Average:58.802; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137414650 | NA | 6.98E-09 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 6.50E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 2.27E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 6.54E-07 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 3.29E-07 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 2.86E-10 | mr1327_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 4.98E-09 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 1.45E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 1.19E-15 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137414650 | NA | 9.41E-07 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/