\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137371529:

Variant ID: vg0137371529 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37371529
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATGGAAGAAAAAATTTTCGTGAAATGTTAAAAAAAACCTAATTCCATAAAAACCGATGCTTTTCCAAAAATTCCTAAAAAAAGATTGATGGGAAAAAA[C/T]
AAAGAGTCCATAAAAAAATCCAATACGGGATATGTAAAAGTTAGGAATAAAAAAAATAAAAAAAGCAAAATTATAAAAAAAAAGAAAAGAAAAGAAGATT

Reverse complement sequence

AATCTTCTTTTCTTTTCTTTTTTTTTATAATTTTGCTTTTTTTATTTTTTTTATTCCTAACTTTTACATATCCCGTATTGGATTTTTTTATGGACTCTTT[G/A]
TTTTTTCCCATCAATCTTTTTTTAGGAATTTTTGGAAAAGCATCGGTTTTTATGGAATTAGGTTTTTTTTAACATTTCACGAAAATTTTTTCTTCCATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.20% 0.11% 0.00% NA
All Indica  2759 98.40% 1.60% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 24.50% 74.30% 1.12% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.40% 1.50% 0.11% 0.00% NA
Indica Intermediate  786 96.30% 3.60% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137371529 C -> T LOC_Os01g64390.1 upstream_gene_variant ; 4820.0bp to feature; MODIFIER silent_mutation Average:14.169; most accessible tissue: Callus, score: 26.701 N N N N
vg0137371529 C -> T LOC_Os01g64380-LOC_Os01g64390 intergenic_region ; MODIFIER silent_mutation Average:14.169; most accessible tissue: Callus, score: 26.701 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137371529 NA 3.52E-23 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 NA 4.20E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 NA 2.94E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 5.54E-06 NA mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 NA 5.16E-26 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 NA 4.83E-26 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 NA 1.00E-09 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 NA 3.16E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 1.51E-06 NA mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137371529 NA 3.54E-21 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251