\
| Variant ID: vg0137371529 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37371529 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAATGGAAGAAAAAATTTTCGTGAAATGTTAAAAAAAACCTAATTCCATAAAAACCGATGCTTTTCCAAAAATTCCTAAAAAAAGATTGATGGGAAAAAA[C/T]
AAAGAGTCCATAAAAAAATCCAATACGGGATATGTAAAAGTTAGGAATAAAAAAAATAAAAAAAGCAAAATTATAAAAAAAAAGAAAAGAAAAGAAGATT
AATCTTCTTTTCTTTTCTTTTTTTTTATAATTTTGCTTTTTTTATTTTTTTTATTCCTAACTTTTACATATCCCGTATTGGATTTTTTTATGGACTCTTT[G/A]
TTTTTTCCCATCAATCTTTTTTTAGGAATTTTTGGAAAAGCATCGGTTTTTATGGAATTAGGTTTTTTTTAACATTTCACGAAAATTTTTTCTTCCATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.20% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 24.50% | 74.30% | 1.12% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137371529 | C -> T | LOC_Os01g64390.1 | upstream_gene_variant ; 4820.0bp to feature; MODIFIER | silent_mutation | Average:14.169; most accessible tissue: Callus, score: 26.701 | N | N | N | N |
| vg0137371529 | C -> T | LOC_Os01g64380-LOC_Os01g64390 | intergenic_region ; MODIFIER | silent_mutation | Average:14.169; most accessible tissue: Callus, score: 26.701 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137371529 | NA | 3.52E-23 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | NA | 4.20E-09 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | NA | 2.94E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | 5.54E-06 | NA | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | NA | 5.16E-26 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | NA | 4.83E-26 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | NA | 1.00E-09 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | NA | 3.16E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | 1.51E-06 | NA | mr1593_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137371529 | NA | 3.54E-21 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |