Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0137351314:

Variant ID: vg0137351314 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37351314
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAAAAAAACATCCATGATCCATTGCTGAAACCAATCTTAACCCTACATGTAGCCGATCATTCTTTCATAGACAACTCGACTTGGTTAGTGCATCAAAT[A/G]
CAAATTATGTGCAGAAGAAGAGTTTTTTGGGTAGATCATATTCAGGAAAAAAAACAACATTGTACTCTAATTAACATTCATTTTTTCTTCAAATAAGAAT

Reverse complement sequence

ATTCTTATTTGAAGAAAAAATGAATGTTAATTAGAGTACAATGTTGTTTTTTTTCCTGAATATGATCTACCCAAAAAACTCTTCTTCTGCACATAATTTG[T/C]
ATTTGATGCACTAACCAAGTCGAGTTGTCTATGAAAGAATGATCGGCTACATGTAGGGTTAAGATTGGTTTCAGCAATGGATCATGGATGTTTTTTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.10%	1.10%	3.47%	47.33%	NA
All Indica	2759	16.80%	1.70%	4.71%	76.73%	NA
All Japonica	1512	98.50%	0.10%	0.20%	1.19%	NA
Aus	269	63.20%	0.40%	8.55%	27.88%	NA
Indica I	595	33.30%	1.00%	8.24%	57.48%	NA
Indica II	465	19.10%	2.20%	6.02%	72.69%	NA
Indica III	913	2.50%	1.50%	1.10%	94.85%	NA
Indica Intermediate	786	19.60%	2.30%	5.47%	72.65%	NA
Temperate Japonica	767	98.40%	0.00%	0.00%	1.56%	NA
Tropical Japonica	504	98.60%	0.20%	0.60%	0.60%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	61.10%	1.10%	7.78%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137351314	A -> G	LOC_Os01g64330.1	5_prime_UTR_variant ; 398.0bp to feature; MODIFIER	silent_mutation	Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394	N	N	N	N
vg0137351314	A -> G	LOC_Os01g64340.1	upstream_gene_variant ; 949.0bp to feature; MODIFIER	silent_mutation	Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394	N	N	N	N
vg0137351314	A -> G	LOC_Os01g64350.1	downstream_gene_variant ; 2074.0bp to feature; MODIFIER	silent_mutation	Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394	N	N	N	N
vg0137351314	A -> G	LOC_Os01g64350.2	downstream_gene_variant ; 2070.0bp to feature; MODIFIER	silent_mutation	Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394	N	N	N	N
vg0137351314	A -> DEL	N	N	silent_mutation	Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0137351314	A	G	0.0	0.0	0.0	0.0	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137351314	NA	5.96E-07	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	5.46E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	8.72E-07	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	3.81E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	1.05E-21	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	1.59E-08	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	4.90E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	2.15E-06	1.86E-07	mr1359_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	2.94E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	2.97E-43	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	5.58E-08	NA	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	1.06E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314	NA	2.25E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251