\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137351314:

Variant ID: vg0137351314 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37351314
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAAAAAAACATCCATGATCCATTGCTGAAACCAATCTTAACCCTACATGTAGCCGATCATTCTTTCATAGACAACTCGACTTGGTTAGTGCATCAAAT[A/G]
CAAATTATGTGCAGAAGAAGAGTTTTTTGGGTAGATCATATTCAGGAAAAAAAACAACATTGTACTCTAATTAACATTCATTTTTTCTTCAAATAAGAAT

Reverse complement sequence

ATTCTTATTTGAAGAAAAAATGAATGTTAATTAGAGTACAATGTTGTTTTTTTTCCTGAATATGATCTACCCAAAAAACTCTTCTTCTGCACATAATTTG[T/C]
ATTTGATGCACTAACCAAGTCGAGTTGTCTATGAAAGAATGATCGGCTACATGTAGGGTTAAGATTGGTTTCAGCAATGGATCATGGATGTTTTTTTTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 1.10% 3.47% 47.33% NA
All Indica  2759 16.80% 1.70% 4.71% 76.73% NA
All Japonica  1512 98.50% 0.10% 0.20% 1.19% NA
Aus  269 63.20% 0.40% 8.55% 27.88% NA
Indica I  595 33.30% 1.00% 8.24% 57.48% NA
Indica II  465 19.10% 2.20% 6.02% 72.69% NA
Indica III  913 2.50% 1.50% 1.10% 94.85% NA
Indica Intermediate  786 19.60% 2.30% 5.47% 72.65% NA
Temperate Japonica  767 98.40% 0.00% 0.00% 1.56% NA
Tropical Japonica  504 98.60% 0.20% 0.60% 0.60% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 61.10% 1.10% 7.78% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137351314 A -> G LOC_Os01g64330.1 5_prime_UTR_variant ; 398.0bp to feature; MODIFIER silent_mutation Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0137351314 A -> G LOC_Os01g64340.1 upstream_gene_variant ; 949.0bp to feature; MODIFIER silent_mutation Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0137351314 A -> G LOC_Os01g64350.1 downstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0137351314 A -> G LOC_Os01g64350.2 downstream_gene_variant ; 2070.0bp to feature; MODIFIER silent_mutation Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0137351314 A -> DEL N N silent_mutation Average:83.334; most accessible tissue: Minghui63 flower, score: 93.394 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0137351314 A G 0.0 0.0 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137351314 NA 5.96E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 5.46E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 8.72E-07 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 3.81E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 1.05E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 1.59E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 4.90E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 2.15E-06 1.86E-07 mr1359_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 2.94E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 2.97E-43 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 5.58E-08 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 1.06E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137351314 NA 2.25E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251