\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137325195:

Variant ID: vg0137325195 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37325195
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGCTAGCACCTTGATTCTGTAAATTATGGACAATTTTGGCCACCTCTTGTGAAATTGCTTATCTGTTGATCATCAGTCATGCTTGATCTGTGAATCA[C/A]
ATTAAAGATGGTACCGTAGGATGTGGAAATAGATTTTGGATTCATAGATTATGTTATTTAGTACTTGAGCTAAACATTTTTTGCTTACTGTGTAGCTATG

Reverse complement sequence

CATAGCTACACAGTAAGCAAAAAATGTTTAGCTCAAGTACTAAATAACATAATCTATGAATCCAAAATCTATTTCCACATCCTACGGTACCATCTTTAAT[G/T]
TGATTCACAGATCAAGCATGACTGATGATCAACAGATAAGCAATTTCACAAGAGGTGGCCAAAATTGTCCATAATTTACAGAATCAAGGTGCTAGCTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 5.10% 0.57% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 82.90% 15.30% 1.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 68.70% 27.90% 3.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137325195 C -> A LOC_Os01g64280.1 upstream_gene_variant ; 4678.0bp to feature; MODIFIER silent_mutation Average:69.142; most accessible tissue: Callus, score: 84.413 N N N N
vg0137325195 C -> A LOC_Os01g64290.1 downstream_gene_variant ; 1691.0bp to feature; MODIFIER silent_mutation Average:69.142; most accessible tissue: Callus, score: 84.413 N N N N
vg0137325195 C -> A LOC_Os01g64300.1 downstream_gene_variant ; 287.0bp to feature; MODIFIER silent_mutation Average:69.142; most accessible tissue: Callus, score: 84.413 N N N N
vg0137325195 C -> A LOC_Os01g64300-LOC_Os01g64310 intergenic_region ; MODIFIER silent_mutation Average:69.142; most accessible tissue: Callus, score: 84.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137325195 3.85E-06 5.86E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 4.45E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 2.28E-06 9.34E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 9.64E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 8.30E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 5.00E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 7.21E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 9.99E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 3.09E-06 1.04E-14 mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 3.84E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 2.55E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137325195 NA 5.95E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251