\
| Variant ID: vg0137325195 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37325195 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 331. )
TTCAGCTAGCACCTTGATTCTGTAAATTATGGACAATTTTGGCCACCTCTTGTGAAATTGCTTATCTGTTGATCATCAGTCATGCTTGATCTGTGAATCA[C/A]
ATTAAAGATGGTACCGTAGGATGTGGAAATAGATTTTGGATTCATAGATTATGTTATTTAGTACTTGAGCTAAACATTTTTTGCTTACTGTGTAGCTATG
CATAGCTACACAGTAAGCAAAAAATGTTTAGCTCAAGTACTAAATAACATAATCTATGAATCCAAAATCTATTTCCACATCCTACGGTACCATCTTTAAT[G/T]
TGATTCACAGATCAAGCATGACTGATGATCAACAGATAAGCAATTTCACAAGAGGTGGCCAAAATTGTCCATAATTTACAGAATCAAGGTGCTAGCTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.30% | 5.10% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 82.90% | 15.30% | 1.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 68.70% | 27.90% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137325195 | C -> A | LOC_Os01g64280.1 | upstream_gene_variant ; 4678.0bp to feature; MODIFIER | silent_mutation | Average:69.142; most accessible tissue: Callus, score: 84.413 | N | N | N | N |
| vg0137325195 | C -> A | LOC_Os01g64290.1 | downstream_gene_variant ; 1691.0bp to feature; MODIFIER | silent_mutation | Average:69.142; most accessible tissue: Callus, score: 84.413 | N | N | N | N |
| vg0137325195 | C -> A | LOC_Os01g64300.1 | downstream_gene_variant ; 287.0bp to feature; MODIFIER | silent_mutation | Average:69.142; most accessible tissue: Callus, score: 84.413 | N | N | N | N |
| vg0137325195 | C -> A | LOC_Os01g64300-LOC_Os01g64310 | intergenic_region ; MODIFIER | silent_mutation | Average:69.142; most accessible tissue: Callus, score: 84.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137325195 | 3.85E-06 | 5.86E-13 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 4.45E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | 2.28E-06 | 9.34E-13 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 9.64E-07 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 8.30E-10 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 5.00E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 7.21E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 9.99E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | 3.09E-06 | 1.04E-14 | mr1182_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 3.84E-08 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 2.55E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137325195 | NA | 5.95E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |