| Variant ID: vg0137296183 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37296183 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATACAAAAAAAGTATGAGAAATGCACAAGATCTAATATGATTAAGATTATACATTATTGGAATTGTTGTATAGAAAATGACATGTTTCAAAGTTCATCAA[C/T]
AGATATCAAATTCAAAAACTAAAAATAAAATGCTTCTACATTTAGACAAGCAGATAATGTATCCCAATTAAAACTTTACAAACCACATTTATGTGGAGTG
CACTCCACATAAATGTGGTTTGTAAAGTTTTAATTGGGATACATTATCTGCTTGTCTAAATGTAGAAGCATTTTATTTTTAGTTTTTGAATTTGATATCT[G/A]
TTGATGAACTTTGAAACATGTCATTTTCTATACAACAATTCCAATAATGTATAATCTTAATCATATTAGATCTTGTGCATTTCTCATACTTTTTTTGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.60% | 12.90% | 1.44% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 58.70% | 36.90% | 4.37% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 62.80% | 30.50% | 6.65% | 0.00% | NA |
| Tropical Japonica | 504 | 50.40% | 48.40% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.10% | 33.20% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 12.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137296183 | C -> T | LOC_Os01g64230.1 | upstream_gene_variant ; 3530.0bp to feature; MODIFIER | silent_mutation | Average:12.558; most accessible tissue: Zhenshan97 flower, score: 20.672 | N | N | N | N |
| vg0137296183 | C -> T | LOC_Os01g64220.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.558; most accessible tissue: Zhenshan97 flower, score: 20.672 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137296183 | NA | 8.39E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137296183 | NA | 9.70E-06 | mr1995 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137296183 | 1.00E-06 | NA | mr1035_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137296183 | NA | 1.44E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137296183 | NA | 1.54E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137296183 | NA | 5.02E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137296183 | NA | 2.28E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137296183 | NA | 4.13E-12 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |