\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137296183:

Variant ID: vg0137296183 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37296183
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACAAAAAAAGTATGAGAAATGCACAAGATCTAATATGATTAAGATTATACATTATTGGAATTGTTGTATAGAAAATGACATGTTTCAAAGTTCATCAA[C/T]
AGATATCAAATTCAAAAACTAAAAATAAAATGCTTCTACATTTAGACAAGCAGATAATGTATCCCAATTAAAACTTTACAAACCACATTTATGTGGAGTG

Reverse complement sequence

CACTCCACATAAATGTGGTTTGTAAAGTTTTAATTGGGATACATTATCTGCTTGTCTAAATGTAGAAGCATTTTATTTTTAGTTTTTGAATTTGATATCT[G/A]
TTGATGAACTTTGAAACATGTCATTTTCTATACAACAATTCCAATAATGTATAATCTTAATCATATTAGATCTTGTGCATTTCTCATACTTTTTTTGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 12.90% 1.44% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 58.70% 36.90% 4.37% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 62.80% 30.50% 6.65% 0.00% NA
Tropical Japonica  504 50.40% 48.40% 1.19% 0.00% NA
Japonica Intermediate  241 63.10% 33.20% 3.73% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137296183 C -> T LOC_Os01g64230.1 upstream_gene_variant ; 3530.0bp to feature; MODIFIER silent_mutation Average:12.558; most accessible tissue: Zhenshan97 flower, score: 20.672 N N N N
vg0137296183 C -> T LOC_Os01g64220.1 intron_variant ; MODIFIER silent_mutation Average:12.558; most accessible tissue: Zhenshan97 flower, score: 20.672 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137296183 NA 8.39E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137296183 NA 9.70E-06 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137296183 1.00E-06 NA mr1035_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137296183 NA 1.44E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137296183 NA 1.54E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137296183 NA 5.02E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137296183 NA 2.28E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137296183 NA 4.13E-12 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251