\
| Variant ID: vg0137283220 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37283220 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATTTTGTGAATGAGGTATTAAAAAATTTATTATTTGAATATATCATTCAGAAAACATTAAGATTAATAAAAAAGATCAAAAAATCATTATGTTGAATTT[T/C]
ACATGAGTGCAGGTTGAACAAAATGGAAATGATTCTATGCAGACTGTCATTGATGCAAAAAAATATGTCTGAGGTGATTCCAGAAATGAATTTTGAAGCT
AGCTTCAAAATTCATTTCTGGAATCACCTCAGACATATTTTTTTGCATCAATGACAGTCTGCATAGAATCATTTCCATTTTGTTCAACCTGCACTCATGT[A/G]
AAATTCAACATAATGATTTTTTGATCTTTTTTATTAATCTTAATGTTTTCTGAATGATATATTCAAATAATAAATTTTTTAATACCTCATTCACAAAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 2.20% | 4.23% | 0.74% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 78.50% | 6.50% | 12.83% | 2.12% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 79.50% | 1.30% | 17.21% | 1.96% | NA |
| Tropical Japonica | 504 | 83.90% | 7.50% | 6.15% | 2.38% | NA |
| Japonica Intermediate | 241 | 63.90% | 21.20% | 12.86% | 2.07% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137283220 | T -> DEL | N | N | silent_mutation | Average:14.059; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0137283220 | T -> C | LOC_Os01g64190.1 | upstream_gene_variant ; 2729.0bp to feature; MODIFIER | silent_mutation | Average:14.059; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0137283220 | T -> C | LOC_Os01g64200.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.059; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137283220 | NA | 3.10E-08 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 2.66E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 4.71E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 7.12E-08 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 3.89E-09 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 1.13E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 9.41E-09 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 1.23E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 1.32E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | 1.86E-06 | 1.85E-06 | mr1197_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 2.04E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 6.45E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137283220 | NA | 1.25E-09 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |