\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137230062:

Variant ID: vg0137230062 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37230062
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTAGAGTGTTATAAAGATGGAAGCACTAATCCTGAGAACACAAGTCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAAC[C/T]
CAAAAGCAAGAACTCGTCGGAACAAAACTAAAGCAAAAAGGTGGCGATGCGCCGAAATTGTGTTGAACGTGTGTGTTAAAAATTACATAGGGCTCGGGGT

Reverse complement sequence

ACCCCGAGCCCTATGTAATTTTTAACACACACGTTCAACACAATTTCGGCGCATCGCCACCTTTTTGCTTTAGTTTTGTTCCGACGAGTTCTTGCTTTTG[G/A]
GTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGACTTGTGTTCTCAGGATTAGTGCTTCCATCTTTATAACACTCTAATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 36.30% 6.33% 0.02% NA
All Indica  2759 31.00% 59.30% 9.64% 0.04% NA
All Japonica  1512 98.30% 1.20% 0.53% 0.00% NA
Aus  269 77.70% 14.90% 7.43% 0.00% NA
Indica I  595 5.50% 81.30% 13.11% 0.00% NA
Indica II  465 17.60% 72.50% 9.89% 0.00% NA
Indica III  913 48.40% 42.90% 8.65% 0.00% NA
Indica Intermediate  786 38.00% 53.80% 8.02% 0.13% NA
Temperate Japonica  767 98.60% 1.00% 0.39% 0.00% NA
Tropical Japonica  504 98.00% 1.20% 0.79% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 73.30% 21.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137230062 C -> T LOC_Os01g64080.1 upstream_gene_variant ; 1054.0bp to feature; MODIFIER silent_mutation Average:19.668; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0137230062 C -> T LOC_Os01g64090.1 upstream_gene_variant ; 1686.0bp to feature; MODIFIER silent_mutation Average:19.668; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0137230062 C -> T LOC_Os01g64080-LOC_Os01g64090 intergenic_region ; MODIFIER silent_mutation Average:19.668; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0137230062 C -> DEL N N silent_mutation Average:19.668; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137230062 NA 1.12E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 7.23E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 5.43E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 8.46E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 1.16E-06 NA mr1474_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 1.17E-06 mr1474_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 4.70E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 3.22E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 4.13E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 7.83E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 4.92E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 4.80E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 7.48E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137230062 NA 1.30E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251