\
| Variant ID: vg0137014902 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37014902 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GACCTCTTTTATCTCAGAAATTATAAAATATTGCCTCCGGTGTCTCACAGCCAATTTCACAAACTTTTATAGTGTCCGTGGGCAAAGCCAAGATTTTGCA[G/C]
TGTCTCACAGCCAATTACACGATTTTTGGGTGTCCTGTAGCAAATTTTGCCGTAGTAGTAAAAGTCAGGGCCGTCTCTAGAAATTTAGGGTCCCGGAGTG
CACTCCGGGACCCTAAATTTCTAGAGACGGCCCTGACTTTTACTACTACGGCAAAATTTGCTACAGGACACCCAAAAATCGTGTAATTGGCTGTGAGACA[C/G]
TGCAAAATCTTGGCTTTGCCCACGGACACTATAAAAGTTTGTGAAATTGGCTGTGAGACACCGGAGGCAATATTTTATAATTTCTGAGATAAAAGAGGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.50% | 69.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137014902 | G -> C | LOC_Os01g63780.1 | upstream_gene_variant ; 3546.0bp to feature; MODIFIER | silent_mutation | Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0137014902 | G -> C | LOC_Os01g63800.1 | upstream_gene_variant ; 2126.0bp to feature; MODIFIER | silent_mutation | Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0137014902 | G -> C | LOC_Os01g63780.2 | upstream_gene_variant ; 3546.0bp to feature; MODIFIER | silent_mutation | Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0137014902 | G -> C | LOC_Os01g63790.1 | downstream_gene_variant ; 1366.0bp to feature; MODIFIER | silent_mutation | Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0137014902 | G -> C | LOC_Os01g63790-LOC_Os01g63800 | intergenic_region ; MODIFIER | silent_mutation | Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137014902 | NA | 2.23E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137014902 | NA | 1.31E-42 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137014902 | 7.71E-10 | 9.19E-57 | mr1550 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137014902 | NA | 2.14E-44 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137014902 | NA | 2.75E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137014902 | NA | 8.22E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137014902 | NA | 1.71E-37 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137014902 | 4.11E-06 | 8.24E-54 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137014902 | NA | 3.45E-32 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |