\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137014902:

Variant ID: vg0137014902 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37014902
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACCTCTTTTATCTCAGAAATTATAAAATATTGCCTCCGGTGTCTCACAGCCAATTTCACAAACTTTTATAGTGTCCGTGGGCAAAGCCAAGATTTTGCA[G/C]
TGTCTCACAGCCAATTACACGATTTTTGGGTGTCCTGTAGCAAATTTTGCCGTAGTAGTAAAAGTCAGGGCCGTCTCTAGAAATTTAGGGTCCCGGAGTG

Reverse complement sequence

CACTCCGGGACCCTAAATTTCTAGAGACGGCCCTGACTTTTACTACTACGGCAAAATTTGCTACAGGACACCCAAAAATCGTGTAATTGGCTGTGAGACA[C/G]
TGCAAAATCTTGGCTTTGCCCACGGACACTATAAAAGTTTGTGAAATTGGCTGTGAGACACCGGAGGCAATATTTTATAATTTCTGAGATAAAAGAGGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 4.50% 0.00% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 30.50% 69.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137014902 G -> C LOC_Os01g63780.1 upstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0137014902 G -> C LOC_Os01g63800.1 upstream_gene_variant ; 2126.0bp to feature; MODIFIER silent_mutation Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0137014902 G -> C LOC_Os01g63780.2 upstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0137014902 G -> C LOC_Os01g63790.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0137014902 G -> C LOC_Os01g63790-LOC_Os01g63800 intergenic_region ; MODIFIER silent_mutation Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137014902 NA 2.23E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902 NA 1.31E-42 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902 7.71E-10 9.19E-57 mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902 NA 2.14E-44 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902 NA 2.75E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902 NA 8.22E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902 NA 1.71E-37 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902 4.11E-06 8.24E-54 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902 NA 3.45E-32 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251