\
| Variant ID: vg0136919523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 36919523 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACCTATTGCAATGCAGTTCAAGTATGGCCAGACCAAGATTGTCTATGCAGAGAACTAGAGAAGTTAAGGCTGACAGTGGTACAGTCAGGCGTCCCTGCTA[A/G]
CCTGACCGTGCAACCTACACTGGAATCGCAAATCCAAGAAGCTCAGAAAGATGATGAAGGTATAAAAGAGTTAATAAAAAGAATACACGAGAAGAAAGAC
GTCTTTCTTCTCGTGTATTCTTTTTATTAACTCTTTTATACCTTCATCATCTTTCTGAGCTTCTTGGATTTGCGATTCCAGTGTAGGTTGCACGGTCAGG[T/C]
TAGCAGGGACGCCTGACTGTACCACTGTCAGCCTTAACTTCTCTAGTTCTCTGCATAGACAATCTTGGTCTGGCCATACTTGAACTGCATTGCAATAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.00% | 34.70% | 13.99% | 14.35% | NA |
| All Indica | 2759 | 4.10% | 52.60% | 21.86% | 21.38% | NA |
| All Japonica | 1512 | 98.10% | 0.30% | 0.46% | 1.06% | NA |
| Aus | 269 | 1.50% | 61.30% | 15.24% | 21.93% | NA |
| Indica I | 595 | 3.40% | 56.60% | 26.05% | 13.95% | NA |
| Indica II | 465 | 3.90% | 24.30% | 24.52% | 47.31% | NA |
| Indica III | 913 | 1.90% | 68.80% | 16.43% | 12.92% | NA |
| Indica Intermediate | 786 | 7.50% | 47.60% | 23.41% | 21.50% | NA |
| Temperate Japonica | 767 | 99.00% | 0.10% | 0.39% | 0.52% | NA |
| Tropical Japonica | 504 | 97.20% | 0.60% | 0.60% | 1.59% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.40% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 92.70% | 5.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 64.40% | 12.20% | 11.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136919523 | A -> G | LOC_Os01g63660.1 | missense_variant ; p.Asn533Ser; MODERATE | nonsynonymous_codon | Average:19.52; most accessible tissue: Callus, score: 51.236 | benign |
-1.386 |
TOLERATED | 0.63 |
| vg0136919523 | A -> DEL | LOC_Os01g63660.1 | N | frameshift_variant | Average:19.52; most accessible tissue: Callus, score: 51.236 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136919523 | NA | 8.78E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | 3.17E-06 | NA | mr1197 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | NA | 2.63E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | NA | 8.71E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | NA | 1.72E-27 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | NA | 2.22E-33 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | NA | 9.54E-27 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | NA | 1.98E-22 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | NA | 2.13E-16 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136919523 | NA | 3.33E-16 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |