\
| Variant ID: vg0136902608 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 36902608 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCGGTCTCTTCGCGTCAGCCGATCGACGTCTCTTCGACTGAGGAGCCGACTACAGGAGGCAGCCAGGCAGGCGAGGAGTAGAGGAGGCCGTCTTCAGCAG[T/C]
TGTCCGTGTGTTAGGCCCCTTTTGTGCCACCGCCACCTCTCTTGGAGTCGTGGCGAGGTAATGCGTGCGTGTGTTTGATGTGGGTGTTGTTTGGTAGTCT
AGACTACCAAACAACACCCACATCAAACACACGCACGCATTACCTCGCCACGACTCCAAGAGAGGTGGCGGTGGCACAAAAGGGGCCTAACACACGGACA[A/G]
CTGCTGAAGACGGCCTCCTCTACTCCTCGCCTGCCTGGCTGCCTCCTGTAGTCGGCTCCTCAGTCGAAGAGACGTCGATCGGCTGACGCGAAGAGACCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.60% | 34.20% | 4.87% | 9.27% | NA |
| All Indica | 2759 | 20.70% | 56.50% | 7.65% | 15.11% | NA |
| All Japonica | 1512 | 98.30% | 0.70% | 0.20% | 0.86% | NA |
| Aus | 269 | 83.60% | 11.90% | 4.46% | 0.00% | NA |
| Indica I | 595 | 8.20% | 72.90% | 8.57% | 10.25% | NA |
| Indica II | 465 | 10.50% | 39.80% | 6.67% | 43.01% | NA |
| Indica III | 913 | 27.40% | 58.90% | 8.11% | 5.59% | NA |
| Indica Intermediate | 786 | 28.40% | 51.30% | 7.00% | 13.36% | NA |
| Temperate Japonica | 767 | 99.00% | 0.30% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 97.40% | 1.60% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 72.20% | 15.60% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136902608 | T -> DEL | N | N | silent_mutation | Average:17.382; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0136902608 | T -> C | LOC_Os01g63630.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.382; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136902608 | NA | 5.05E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136902608 | NA | 2.46E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136902608 | NA | 1.75E-15 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136902608 | NA | 1.90E-13 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136902608 | NA | 2.29E-16 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136902608 | 7.02E-06 | 4.60E-19 | mr1686_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |