\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136682930:

Variant ID: vg0136682930 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 36682930
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAGAGATGTGAAGCTAGAGTTGTAGCTCAGCCAAACAACCCATAAGATGTTTCCTATGACCCATATAACAAGTTTTTACTGGATTGAGATCAGCTGCA[G/A]
TGGTAACTACAACTGCAACTTAGGACTGCACATATCTTCAGCCATTCATTTTGATGATCAGCGGTCTAGATTTACCGCTACAATGATCAAACTACAGAAT

Reverse complement sequence

ATTCTGTAGTTTGATCATTGTAGCGGTAAATCTAGACCGCTGATCATCAAAATGAATGGCTGAAGATATGTGCAGTCCTAAGTTGCAGTTGTAGTTACCA[C/T]
TGCAGCTGATCTCAATCCAGTAAAAACTTGTTATATGGGTCATAGGAAACATCTTATGGGTTGTTTGGCTGAGCTACAACTCTAGCTTCACATCTCTTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.40% 0.13% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 83.70% 15.90% 0.40% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 98.00% 1.60% 0.39% 0.00% NA
Tropical Japonica  504 72.60% 27.20% 0.20% 0.00% NA
Japonica Intermediate  241 61.00% 38.20% 0.83% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0136682930 G -> A LOC_Os01g63280.2 downstream_gene_variant ; 779.0bp to feature; MODIFIER silent_mutation Average:69.355; most accessible tissue: Callus, score: 83.738 N N N N
vg0136682930 G -> A LOC_Os01g63290.1 downstream_gene_variant ; 4615.0bp to feature; MODIFIER silent_mutation Average:69.355; most accessible tissue: Callus, score: 83.738 N N N N
vg0136682930 G -> A LOC_Os01g63280.1 downstream_gene_variant ; 779.0bp to feature; MODIFIER silent_mutation Average:69.355; most accessible tissue: Callus, score: 83.738 N N N N
vg0136682930 G -> A LOC_Os01g63280.3 downstream_gene_variant ; 779.0bp to feature; MODIFIER silent_mutation Average:69.355; most accessible tissue: Callus, score: 83.738 N N N N
vg0136682930 G -> A LOC_Os01g63290.2 downstream_gene_variant ; 4615.0bp to feature; MODIFIER silent_mutation Average:69.355; most accessible tissue: Callus, score: 83.738 N N N N
vg0136682930 G -> A LOC_Os01g63270-LOC_Os01g63280 intergenic_region ; MODIFIER silent_mutation Average:69.355; most accessible tissue: Callus, score: 83.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0136682930 NA 4.99E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930 NA 4.86E-10 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930 NA 1.77E-10 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930 NA 9.91E-07 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930 1.70E-07 1.64E-10 mr1947_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930 6.56E-06 6.56E-06 mr1947_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251