\
| Variant ID: vg0136682930 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 36682930 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )
CCAAGAGATGTGAAGCTAGAGTTGTAGCTCAGCCAAACAACCCATAAGATGTTTCCTATGACCCATATAACAAGTTTTTACTGGATTGAGATCAGCTGCA[G/A]
TGGTAACTACAACTGCAACTTAGGACTGCACATATCTTCAGCCATTCATTTTGATGATCAGCGGTCTAGATTTACCGCTACAATGATCAAACTACAGAAT
ATTCTGTAGTTTGATCATTGTAGCGGTAAATCTAGACCGCTGATCATCAAAATGAATGGCTGAAGATATGTGCAGTCCTAAGTTGCAGTTGTAGTTACCA[C/T]
TGCAGCTGATCTCAATCCAGTAAAAACTTGTTATATGGGTCATAGGAAACATCTTATGGGTTGTTTGGCTGAGCTACAACTCTAGCTTCACATCTCTTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 83.70% | 15.90% | 0.40% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.00% | 1.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 72.60% | 27.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.00% | 38.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136682930 | G -> A | LOC_Os01g63280.2 | downstream_gene_variant ; 779.0bp to feature; MODIFIER | silent_mutation | Average:69.355; most accessible tissue: Callus, score: 83.738 | N | N | N | N |
| vg0136682930 | G -> A | LOC_Os01g63290.1 | downstream_gene_variant ; 4615.0bp to feature; MODIFIER | silent_mutation | Average:69.355; most accessible tissue: Callus, score: 83.738 | N | N | N | N |
| vg0136682930 | G -> A | LOC_Os01g63280.1 | downstream_gene_variant ; 779.0bp to feature; MODIFIER | silent_mutation | Average:69.355; most accessible tissue: Callus, score: 83.738 | N | N | N | N |
| vg0136682930 | G -> A | LOC_Os01g63280.3 | downstream_gene_variant ; 779.0bp to feature; MODIFIER | silent_mutation | Average:69.355; most accessible tissue: Callus, score: 83.738 | N | N | N | N |
| vg0136682930 | G -> A | LOC_Os01g63290.2 | downstream_gene_variant ; 4615.0bp to feature; MODIFIER | silent_mutation | Average:69.355; most accessible tissue: Callus, score: 83.738 | N | N | N | N |
| vg0136682930 | G -> A | LOC_Os01g63270-LOC_Os01g63280 | intergenic_region ; MODIFIER | silent_mutation | Average:69.355; most accessible tissue: Callus, score: 83.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136682930 | NA | 4.99E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136682930 | NA | 4.86E-10 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136682930 | NA | 1.77E-10 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136682930 | NA | 9.91E-07 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136682930 | 1.70E-07 | 1.64E-10 | mr1947_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136682930 | 6.56E-06 | 6.56E-06 | mr1947_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |