Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136682930:

Variant ID: vg0136682930 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 36682930
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAGAGATGTGAAGCTAGAGTTGTAGCTCAGCCAAACAACCCATAAGATGTTTCCTATGACCCATATAACAAGTTTTTACTGGATTGAGATCAGCTGCA[G/A]
TGGTAACTACAACTGCAACTTAGGACTGCACATATCTTCAGCCATTCATTTTGATGATCAGCGGTCTAGATTTACCGCTACAATGATCAAACTACAGAAT

Reverse complement sequence

ATTCTGTAGTTTGATCATTGTAGCGGTAAATCTAGACCGCTGATCATCAAAATGAATGGCTGAAGATATGTGCAGTCCTAAGTTGCAGTTGTAGTTACCA[C/T]
TGCAGCTGATCTCAATCCAGTAAAAACTTGTTATATGGGTCATAGGAAACATCTTATGGGTTGTTTGGCTGAGCTACAACTCTAGCTTCACATCTCTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	7.40%	0.13%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	83.70%	15.90%	0.40%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	98.00%	1.60%	0.39%	0.00%	NA
Tropical Japonica	504	72.60%	27.20%	0.20%	0.00%	NA
Japonica Intermediate	241	61.00%	38.20%	0.83%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0136682930	G -> A	LOC_Os01g63280.2	downstream_gene_variant ; 779.0bp to feature; MODIFIER	silent_mutation	Average:69.355; most accessible tissue: Callus, score: 83.738	N	N	N	N
vg0136682930	G -> A	LOC_Os01g63290.1	downstream_gene_variant ; 4615.0bp to feature; MODIFIER	silent_mutation	Average:69.355; most accessible tissue: Callus, score: 83.738	N	N	N	N
vg0136682930	G -> A	LOC_Os01g63280.1	downstream_gene_variant ; 779.0bp to feature; MODIFIER	silent_mutation	Average:69.355; most accessible tissue: Callus, score: 83.738	N	N	N	N
vg0136682930	G -> A	LOC_Os01g63280.3	downstream_gene_variant ; 779.0bp to feature; MODIFIER	silent_mutation	Average:69.355; most accessible tissue: Callus, score: 83.738	N	N	N	N
vg0136682930	G -> A	LOC_Os01g63290.2	downstream_gene_variant ; 4615.0bp to feature; MODIFIER	silent_mutation	Average:69.355; most accessible tissue: Callus, score: 83.738	N	N	N	N
vg0136682930	G -> A	LOC_Os01g63270-LOC_Os01g63280	intergenic_region ; MODIFIER	silent_mutation	Average:69.355; most accessible tissue: Callus, score: 83.738	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0136682930	NA	4.99E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930	NA	4.86E-10	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930	NA	1.77E-10	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930	NA	9.91E-07	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930	1.70E-07	1.64E-10	mr1947_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136682930	6.56E-06	6.56E-06	mr1947_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251