\
| Variant ID: vg0136593923 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 36593923 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 105. )
AATAAAGCCCTATTATTGACCTCTAAGCGTGCCATTAGATAGATCTCGAGATTTGAGGAATTTTAGAAGTTGAACGGAGTCAAACGGACTTACGGTTGAG[A/G]
AGATATTGAATTTATAAGATTATTGGATTTTTGGTCTAAAGGAAAAGGATTTATTTAAATCCTTTTTGGAAAAGAAAAGAAAAGAAAAGAAGAAGGGAGG
CCTCCCTTCTTCTTTTCTTTTCTTTTCTTTTCCAAAAAGGATTTAAATAAATCCTTTTCCTTTAGACCAAAAATCCAATAATCTTATAAATTCAATATCT[T/C]
CTCAACCGTAAGTCCGTTTGACTCCGTTCAACTTCTAAAATTCCTCAAATCTCGAGATCTATCTAATGGCACGCTTAGAGGTCAATAATAGGGCTTTATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.00% | 47.90% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 19.50% | 80.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 32.60% | 67.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 4.30% | 95.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 17.20% | 82.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 21.40% | 78.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136593923 | A -> G | LOC_Os01g63150.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.127; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136593923 | 1.44E-07 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136593923 | 1.29E-06 | 1.38E-08 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136593923 | 2.40E-07 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136593923 | 5.75E-06 | 4.63E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136593923 | NA | 6.61E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136593923 | 8.60E-06 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136593923 | NA | 2.99E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136593923 | 9.59E-08 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136593923 | 3.85E-06 | 2.87E-07 | mr1538_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |