\
| Variant ID: vg0136579184 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 36579184 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGTGACTGTGCGACTCGCACAATCGATGGCTCCCTTAAACTTGGTTAGCCAATCCATCCCAAGAATGACATCTAGGTCTTTGGATTCGAGAAGAATGAG[G/A]
TTGGCTAGAAATGGTGATCTTTGAATTTCTATTGTGATAGAAGGGCTGAATTGTACCGAAGTGGAACTATTCCCCGGGGTATGAACCCGCATGGGTGTGC
GCACACCCATGCGGGTTCATACCCCGGGGAATAGTTCCACTTCGGTACAATTCAGCCCTTCTATCACAATAGAAATTCAAAGATCACCATTTCTAGCCAA[C/T]
CTCATTCTTCTCGAATCCAAAGACCTAGATGTCATTCTTGGGATGGATTGGCTAACCAAGTTTAAGGGAGCCATCGATTGTGCGAGTCGCACAGTCACCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.40% | 5.10% | 3.17% | 42.32% | NA |
| All Indica | 2759 | 19.30% | 8.30% | 4.75% | 67.67% | NA |
| All Japonica | 1512 | 98.30% | 0.10% | 0.13% | 1.52% | NA |
| Aus | 269 | 83.30% | 4.10% | 4.46% | 8.18% | NA |
| Indica I | 595 | 19.50% | 1.00% | 3.36% | 76.13% | NA |
| Indica II | 465 | 17.00% | 30.10% | 8.60% | 44.30% | NA |
| Indica III | 913 | 13.90% | 1.60% | 2.96% | 81.49% | NA |
| Indica Intermediate | 786 | 26.80% | 8.50% | 5.60% | 59.03% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 97.60% | 0.20% | 0.20% | 1.98% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 33.30% | 0.00% | 3.12% | 63.54% | NA |
| Intermediate | 90 | 64.40% | 3.30% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136579184 | G -> A | LOC_Os01g63120.1 | synonymous_variant ; p.Asn471Asn; LOW | synonymous_codon | Average:7.909; most accessible tissue: Callus, score: 33.104 | N | N | N | N |
| vg0136579184 | G -> DEL | LOC_Os01g63120.1 | N | frameshift_variant | Average:7.909; most accessible tissue: Callus, score: 33.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136579184 | NA | 2.16E-06 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 3.85E-10 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 2.14E-09 | mr1322_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 6.11E-06 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 2.80E-06 | mr1325_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 4.60E-07 | mr1326_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 5.53E-08 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 3.26E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 1.97E-06 | mr1338_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 8.44E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 7.90E-08 | mr1449_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 4.90E-08 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 5.18E-08 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136579184 | NA | 8.39E-06 | mr1899_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |