\
| Variant ID: vg0136576949 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 36576949 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATTTAAACGGGTCCCCAATTCTTCCTGCAGTTTCTGCCAAAATTTTGAGGTGAACTGGCTACCTCGGTCAGATACTATCTTTTTGGGTACTCCATGTAA[A/G]
CACATGATCCTTGCGAGGTACAATTATGCCAATTTCTTTCCCGTATAGGTGGTATGTACTGGTATAAAGTGAGCCACCTTGGTGAGTCGATCCACGACTA
TAGTCGTGGATCGACTCACCAAGGTGGCTCACTTTATACCAGTACATACCACCTATACGGGAAAGAAATTGGCATAATTGTACCTCGCAAGGATCATGTG[T/C]
TTACATGGAGTACCCAAAAAGATAGTATCTGACCGAGGTAGCCAGTTCACCTCAAAATTTTGGCAGAAACTGCAGGAAGAATTGGGGACCCGTTTAAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 35.70% | 9.10% | 5.14% | NA |
| All Indica | 2759 | 78.30% | 10.00% | 10.76% | 0.94% | NA |
| All Japonica | 1512 | 1.70% | 83.40% | 1.59% | 13.29% | NA |
| Aus | 269 | 31.60% | 35.70% | 32.34% | 0.37% | NA |
| Indica I | 595 | 85.90% | 4.50% | 9.24% | 0.34% | NA |
| Indica II | 465 | 58.30% | 19.40% | 21.51% | 0.86% | NA |
| Indica III | 913 | 88.60% | 5.60% | 4.82% | 0.99% | NA |
| Indica Intermediate | 786 | 72.40% | 13.70% | 12.47% | 1.40% | NA |
| Temperate Japonica | 767 | 0.90% | 90.20% | 2.74% | 6.13% | NA |
| Tropical Japonica | 504 | 2.60% | 73.00% | 0.40% | 24.01% | NA |
| Japonica Intermediate | 241 | 2.50% | 83.40% | 0.41% | 13.69% | NA |
| VI/Aromatic | 96 | 69.80% | 17.70% | 10.42% | 2.08% | NA |
| Intermediate | 90 | 32.20% | 40.00% | 13.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136576949 | A -> G | LOC_Os01g63110.1 | upstream_gene_variant ; 4940.0bp to feature; MODIFIER | silent_mutation | Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg0136576949 | A -> G | LOC_Os01g63130.1 | downstream_gene_variant ; 3897.0bp to feature; MODIFIER | silent_mutation | Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg0136576949 | A -> G | LOC_Os01g63120.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg0136576949 | A -> DEL | N | N | silent_mutation | Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136576949 | 3.89E-06 | 3.89E-06 | mr1358 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 5.70E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 8.72E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 8.83E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 5.89E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 2.05E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 3.76E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 6.78E-08 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 5.30E-06 | mr1622 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 5.70E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136576949 | NA | 4.78E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |