\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136576949:

Variant ID: vg0136576949 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 36576949
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTAAACGGGTCCCCAATTCTTCCTGCAGTTTCTGCCAAAATTTTGAGGTGAACTGGCTACCTCGGTCAGATACTATCTTTTTGGGTACTCCATGTAA[A/G]
CACATGATCCTTGCGAGGTACAATTATGCCAATTTCTTTCCCGTATAGGTGGTATGTACTGGTATAAAGTGAGCCACCTTGGTGAGTCGATCCACGACTA

Reverse complement sequence

TAGTCGTGGATCGACTCACCAAGGTGGCTCACTTTATACCAGTACATACCACCTATACGGGAAAGAAATTGGCATAATTGTACCTCGCAAGGATCATGTG[T/C]
TTACATGGAGTACCCAAAAAGATAGTATCTGACCGAGGTAGCCAGTTCACCTCAAAATTTTGGCAGAAACTGCAGGAAGAATTGGGGACCCGTTTAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 35.70% 9.10% 5.14% NA
All Indica  2759 78.30% 10.00% 10.76% 0.94% NA
All Japonica  1512 1.70% 83.40% 1.59% 13.29% NA
Aus  269 31.60% 35.70% 32.34% 0.37% NA
Indica I  595 85.90% 4.50% 9.24% 0.34% NA
Indica II  465 58.30% 19.40% 21.51% 0.86% NA
Indica III  913 88.60% 5.60% 4.82% 0.99% NA
Indica Intermediate  786 72.40% 13.70% 12.47% 1.40% NA
Temperate Japonica  767 0.90% 90.20% 2.74% 6.13% NA
Tropical Japonica  504 2.60% 73.00% 0.40% 24.01% NA
Japonica Intermediate  241 2.50% 83.40% 0.41% 13.69% NA
VI/Aromatic  96 69.80% 17.70% 10.42% 2.08% NA
Intermediate  90 32.20% 40.00% 13.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0136576949 A -> G LOC_Os01g63110.1 upstream_gene_variant ; 4940.0bp to feature; MODIFIER silent_mutation Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N
vg0136576949 A -> G LOC_Os01g63130.1 downstream_gene_variant ; 3897.0bp to feature; MODIFIER silent_mutation Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N
vg0136576949 A -> G LOC_Os01g63120.1 intron_variant ; MODIFIER silent_mutation Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N
vg0136576949 A -> DEL N N silent_mutation Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0136576949 3.89E-06 3.89E-06 mr1358 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 5.70E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 8.72E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 8.83E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 5.89E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 2.05E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 3.76E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 6.78E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 5.30E-06 mr1622 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 5.70E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949 NA 4.78E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251