\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136420795:

Variant ID: vg0136420795 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 36420795
Reference Allele: TAAlternative Allele: TAA,AA,T
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTAAGGAGACTACATGAGGTCATCCAGAGGAAGCAGCTTACTGCAAAAATAAAATAAATTATATGTTGAGTTCATTATTTATTTAGTTGTTTTTTTTA[TA/TAA,AA,T]
AAAAAAAAACTATGGTCTAGAATAGTATGTATGGAGGTCAGTGCTTTATACTAACCGACAGAAAATAATACAACAAAAACCCATCGAGGCCGGCCACAAA

Reverse complement sequence

TTTGTGGCCGGCCTCGATGGGTTTTTGTTGTATTATTTTCTGTCGGTTAGTATAAAGCACTGACCTCCATACATACTATTCTAGACCATAGTTTTTTTTT[TA/TTA,TT,A]
TAAAAAAAACAACTAAATAAATAATGAACTCAACATATAATTTATTTTATTTTTGCAGTAAGCTGCTTCCTCTGGATGACCTCATGTAGTCTCCTTACGG

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 14.40% 0.83% 3.70% T: 0.89%; TAA: 0.34%
All Indica  2759 78.70% 20.00% 0.18% 1.01% TAA: 0.07%; T: 0.04%
All Japonica  1512 95.20% 0.30% 1.85% 0.00% T: 2.18%; TAA: 0.46%
Aus  269 1.50% 42.80% 1.49% 54.28% NA
Indica I  595 61.30% 37.60% 0.17% 0.67% TAA: 0.17%
Indica II  465 95.90% 3.40% 0.00% 0.43% TAA: 0.22%
Indica III  913 80.40% 18.40% 0.11% 0.99% T: 0.11%
Indica Intermediate  786 79.80% 18.20% 0.38% 1.65% NA
Temperate Japonica  767 96.90% 0.30% 2.35% 0.00% TAA: 0.52%
Tropical Japonica  504 91.10% 0.60% 1.39% 0.00% T: 6.55%; TAA: 0.40%
Japonica Intermediate  241 98.30% 0.00% 1.24% 0.00% TAA: 0.41%
VI/Aromatic  96 85.40% 0.00% 2.08% 0.00% T: 6.25%; TAA: 6.25%
Intermediate  90 84.40% 11.10% 0.00% 1.11% T: 2.22%; TAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0136420795 TA -> TAA LOC_Os01g62880.1 downstream_gene_variant ; 342.0bp to feature; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> TAA LOC_Os01g62880.2 downstream_gene_variant ; 342.0bp to feature; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> TAA LOC_Os01g62890.1 intron_variant ; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> TAA LOC_Os01g62890.2 intron_variant ; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> AA LOC_Os01g62880.1 downstream_gene_variant ; 340.0bp to feature; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> AA LOC_Os01g62880.2 downstream_gene_variant ; 340.0bp to feature; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> AA LOC_Os01g62890.1 intron_variant ; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> AA LOC_Os01g62890.2 intron_variant ; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> DEL N N silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> T LOC_Os01g62880.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> T LOC_Os01g62880.2 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> T LOC_Os01g62890.1 intron_variant ; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N
vg0136420795 TA -> T LOC_Os01g62890.2 intron_variant ; MODIFIER silent_mutation Average:61.457; most accessible tissue: Callus, score: 87.064 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0136420795 NA 1.02E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136420795 NA 1.21E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136420795 NA 3.77E-06 mr1693 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136420795 NA 3.83E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136420795 NA 1.81E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136420795 NA 6.89E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136420795 NA 8.63E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251