\
| Variant ID: vg0136420795 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 36420795 |
| Reference Allele: TA | Alternative Allele: TAA,AA,T |
| Primary Allele: TA | Secondary Allele: AA |
Inferred Ancestral Allele: Not determined.
CCGTAAGGAGACTACATGAGGTCATCCAGAGGAAGCAGCTTACTGCAAAAATAAAATAAATTATATGTTGAGTTCATTATTTATTTAGTTGTTTTTTTTA[TA/TAA,AA,T]
AAAAAAAAACTATGGTCTAGAATAGTATGTATGGAGGTCAGTGCTTTATACTAACCGACAGAAAATAATACAACAAAAACCCATCGAGGCCGGCCACAAA
TTTGTGGCCGGCCTCGATGGGTTTTTGTTGTATTATTTTCTGTCGGTTAGTATAAAGCACTGACCTCCATACATACTATTCTAGACCATAGTTTTTTTTT[TA/TTA,TT,A]
TAAAAAAAACAACTAAATAAATAATGAACTCAACATATAATTTATTTTATTTTTGCAGTAAGCTGCTTCCTCTGGATGACCTCATGTAGTCTCCTTACGG
| Populations | Population Size | Frequency of TA(primary allele) | Frequency of AA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 14.40% | 0.83% | 3.70% | T: 0.89%; TAA: 0.34% |
| All Indica | 2759 | 78.70% | 20.00% | 0.18% | 1.01% | TAA: 0.07%; T: 0.04% |
| All Japonica | 1512 | 95.20% | 0.30% | 1.85% | 0.00% | T: 2.18%; TAA: 0.46% |
| Aus | 269 | 1.50% | 42.80% | 1.49% | 54.28% | NA |
| Indica I | 595 | 61.30% | 37.60% | 0.17% | 0.67% | TAA: 0.17% |
| Indica II | 465 | 95.90% | 3.40% | 0.00% | 0.43% | TAA: 0.22% |
| Indica III | 913 | 80.40% | 18.40% | 0.11% | 0.99% | T: 0.11% |
| Indica Intermediate | 786 | 79.80% | 18.20% | 0.38% | 1.65% | NA |
| Temperate Japonica | 767 | 96.90% | 0.30% | 2.35% | 0.00% | TAA: 0.52% |
| Tropical Japonica | 504 | 91.10% | 0.60% | 1.39% | 0.00% | T: 6.55%; TAA: 0.40% |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.24% | 0.00% | TAA: 0.41% |
| VI/Aromatic | 96 | 85.40% | 0.00% | 2.08% | 0.00% | T: 6.25%; TAA: 6.25% |
| Intermediate | 90 | 84.40% | 11.10% | 0.00% | 1.11% | T: 2.22%; TAA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136420795 | TA -> TAA | LOC_Os01g62880.1 | downstream_gene_variant ; 342.0bp to feature; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> TAA | LOC_Os01g62880.2 | downstream_gene_variant ; 342.0bp to feature; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> TAA | LOC_Os01g62890.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> TAA | LOC_Os01g62890.2 | intron_variant ; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> AA | LOC_Os01g62880.1 | downstream_gene_variant ; 340.0bp to feature; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> AA | LOC_Os01g62880.2 | downstream_gene_variant ; 340.0bp to feature; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> AA | LOC_Os01g62890.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> AA | LOC_Os01g62890.2 | intron_variant ; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> DEL | N | N | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> T | LOC_Os01g62880.1 | downstream_gene_variant ; 341.0bp to feature; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> T | LOC_Os01g62880.2 | downstream_gene_variant ; 341.0bp to feature; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> T | LOC_Os01g62890.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| vg0136420795 | TA -> T | LOC_Os01g62890.2 | intron_variant ; MODIFIER | silent_mutation | Average:61.457; most accessible tissue: Callus, score: 87.064 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136420795 | NA | 1.02E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136420795 | NA | 1.21E-20 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136420795 | NA | 3.77E-06 | mr1693 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136420795 | NA | 3.83E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136420795 | NA | 1.81E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136420795 | NA | 6.89E-06 | mr1788 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136420795 | NA | 8.63E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |